... Arabia 57.8 Singapore 24.9 Macao, China 56.1 New Zealand 24.9 United Kingdom 56.0 Slovenia 24.2 Spain 55.7 Australia 24.2 Denmark 54.7 Macao, China 24.2 United States 54.0 Austria 23.9 Ireland ... 5’000 Africa Arab States Asia & Pacific CIS Note: * Estimate Source: ITU World Telecommunication/ICT Indicators database Americas World Europe The World in 2011 — ICT Facts and Figures Active ... leads in broadband connectivity, with fixed- and mobile-broadband penetration reaching 26% and 54%, respectively Active mobilebroadband subscriptions per 100 inhabitants* Netherlands 38.1 Korea...
Ngày tải lên: 18/02/2014, 01:20
... Public Health Agency, Barcelona, Spain a Natalia Valero Muñoz Public Health Agency, Barcelona, Spain a Miguel Angel Espinosa Martinez Andalusian School of Public Health, Granada, Spain a Alejandro ... Ukraine Belarus Armenia Bulgaria Russian Federation Bosnia and Herzegovina R U Albania Croatia Lithuania Estonia Latvia Slovakia Finland Czech Republic Austria Switzerland Netherlands Rural Urban Sweden ... shows that substantial relevant data are available, they can be gathered and analysed in a comparable way, and they can be a very useful tool for overall assessment of the environment and health...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... Polyplacophora) and the oyster Crassostrea gigas (Mollusca, Bivalvia) Sequence data were deposited in GenBank (Table S1) Searches in databases Using the putative C-terminal domain of C fluminea as a query, ... FEBS 2335 Linkers in modular a- amylases G Feller et al Table Amino acid frequencies (%) in a- amylase linkers, in a set of globular proteins, in the Swiss-Prot databank and in intrinsically unstructured ... this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase (listed in Table S1), as...
Ngày tải lên: 14/02/2014, 18:20
''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx
... engagement in the DRC and throughout the Great Lakes Region In 2007, Canada terminated the mandate of the Canadian ambassador to the Great Lakes Region, who had represented Canada in peace processes in ... security and equality in the midst of the war that has singled out their bodies as the battlefield Canadians have a stake in the worst place in the world to be a woman or a girl and have both the ability ... Operations “Lance” in Rwanda, “Scotch” in the DRC, and “Passage” in Rwanda and “Assurance” in the DRC all testify to Canadian military involvement in this region, however meagre Canada’s involvement...
Ngày tải lên: 22/03/2014, 21:20
02 write it in arabic a workbook and step-by-step guide to writing the arabic alphabet
Ngày tải lên: 03/04/2014, 12:40
state university of new york press aristotle on false reasoning language and the world in the sophistical refutations mar 2003
... The entire example, then, provides a particularly apt introduction to the general danger of mistaking appearances for the realities that they mimic Aristotle is warning against assimilating the ... such a class, only what Aristotle agrees to call an indenite name (noma ơriston) Names and indenite names are alike in that they both signify and can be applied to multiple individuals They differ ... in argumentation: premises that appear to be what they are not, arguments that appear to be valid when they are not, and valid arguments that appear to be relevant to the matter at hand when they...
Ngày tải lên: 11/06/2014, 12:45
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx
... related to the participant's oral impact In other words, occlusal traits that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI ... were assessed and a score was obtained using the equation: 6×(missing visible teeth) + crowding + spacing + 3×(diastema) + largest anterior maxillary irregularity + largest anterior mandibular ... Sheiham A, Tsakos G: A sociodental approach to assessing children's oral health needs: integrating an oral health-related quality of life (OHRQoL) measure into oral health service planning Bull World...
Ngày tải lên: 18/06/2014, 19:20
The Environment in Anthropology - A Reader in Ecology, Culture, and Sustainable Living pot
... Academic Press Sweet, L 1965 Camel Pastoralism in N Arabia and the Minimal Camping Unit Man, Culture, and Animals Edited by A Leeds and A P Vayda Washington, DC: AAAS Thomas, R B 1973 Human Adaptation ... Cultural Ecology are similar the Bushmen, Australians, and southern Californians live in deserts, the Negritoes in rain forests, and the Fuegians in a cold, rainy area—but because the nature of the ... Negritoes, Australians, Tasmanians, Fuegians, and others These latter groups consisting of patrilineal bands are similar, as a matter of fact, not because their total environments The Concept and Method...
Ngày tải lên: 27/06/2014, 16:20
Báo cáo y học: " Short distance movement of genomic negative strands in a host and nonhost for Sugarcane mosaic virus (SCMV)" docx
... divided in four sectors using the inoculation zone as a reference: two sectors in each the apical and basal halves Each was subdivided into proximal and distal areas from the point of inoculation ... relative to the inoculation site S 4A and S4B are apical proximal and basal distal regions on a systemic leaf number Noninoculated leaves are indicated as NI strands, i.e., negative genomic strands, ... reactions showing either the presence or absence of the negative amplified strands of SCMV-VER1 and SCMV-CAM6 in maize (L3 and L5) and sugarcane (L1 and L3), in the inoculated and systemic leaves,...
Ngày tải lên: 11/08/2014, 21:21
báo cáo khoa học:" Distant metastases of a squamous cell carcinoma of the tongue in peripheral skeletal muscles and adjacent soft tissues" doc
... the internal mammary artery Another metastasis emerged within the thoracic cavity in the right paraaortal soft tissue sheath A metastasis measuring approximately cm in diameter was detected in ... with the delicate task to choose a reasonable balance between minimal and maximal diagnostic means that are available and treat the patient with respect, which is a basic requirement A PETCT Scan ... MH analyzed the data RS, OM, MBG and MH contributed to writing the paper DR supervised the clinical treatment and data collection RS and OM wrote the main part of the paper All authors gave useful...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG ... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC ACTCGAGGCCTGTGAATTCC 93.73 GCCGGCTCCCAAGCTCC 92.03 CCTGCTGGCCATGCTCCTCAGC 92.99 GCTGCCTCTGCTCCCAGG 91.88 ACAAATCACCTCTGTCACCC...
Ngày tải lên: 12/08/2014, 16:20
List of countries and capital cities around the world in english
... Swaziland - Mbabana Sweden - Stockholm Switzerland - Bern Syria - Damascus Taiwan - Taipei Tajikistan - Dushanbe Tanzania - Dar es Salaam Thailand - Bangkok The Bahamas - Nassau The Gambia - Banjul ... Reykjavik India - New Delhi Indonesia - Jakarta Iran - Tehran Iraq - Baghdad Ireland - Dublin Israel - Jerusalem Italy - Rome Jamaica - Kingston Japan - Tokyo Jordan - Amman Kazakhstan - Astana ... Tonga - Nuku'alofa Trinidad and Tobago - Port-of-Spain Tunisia - Tunis Turkey - Ankara Turkmenistan - Ashgabat Tuvalu - Funafuti Uganda - Kampala Ukraine - Kiev United Arab Emirates - Abu Dhabi...
Ngày tải lên: 07/08/2015, 22:27
A popular history of the PRC narratives of the nation in best selling biographies and memoirs
... of the state and the market Processes of this interaction are still underway and play a central role in defining the character of popular reading today 53 Xin, Publishing in China, p 18 Yu Ming ... that the nation and the state are distinct entities and allegiances, but that nationalism is often 26 Duara, Rescuing History, p 81 Rebecca Karl, Staging the World: Chinese Nationalism at the ... its role and image away from that of a “class party” towards that of a “national party,” for instance, it has apparently “taken on board some of the ideas and elements of cultural nationalism.”34...
Ngày tải lên: 26/09/2015, 09:39
The world in the network the interop trade show, carl malamuds internet 1996 exposition, and the politics of internet commercialization
... These include Karl Auerbach, David Brandin, David Clark, Dave Crocker, Tom Keating, Ole Jacobsen, Dan Lynch, Tom Keating, Carl Malamud, Howard Rheingold, Andy Lippman, Marty Lucas, and Marshall ... on the part of human participants, who are notoriously apt to misunderstand and resist As a result, maintaining adherence to a standard involves ongoing adjustments to people, practices, and machines ... energy-that rationally engineer the world and order it in a way that facilitates the circulation of goods and ideas They are also conceptual, cultural devices that are powerful as a mode of regulating...
Ngày tải lên: 15/10/2015, 09:32
Welfare and economy wide effects of azerbaijan’s accession to the world trade organization a quantitative assessment
... and Azerbaijan The WTO is a legal and institutional organization that regulates multilateral trade The organization’s overriding objectives are to let world trade flow as freely as possible and ... nations) and thus increases the competitive position of manufacturing and agricultural sectors in the local and international markets These insights have been reiterated in the Azerbaijani context ... leading players in WTO: the USA, EU, Canada, and Japan 2.2 Azerbaijan’s agricultural sector, agricultural policy, and WTO requirements 2.2.1 Agriculture sector in Azerbaijan As a traditional production...
Ngày tải lên: 26/11/2015, 10:00
Cambridge.University.Press.The.American.Puritan.Elegy.A.Literary.and.Cultural.Study.Jun.2000.pdf
... can make the past more appealing, they invoke historical sameness prematurely and thus obscure the past’s fundamental and inescapable alterity In countering the tendency to refigure the past as ... have posed a sharper contrast to the classically based pastoral, in which the frank artifice of a timeless and placeless landscape encouraged a retreat from mutability into the static sanctuary ... to make these old poems as interesting to them as they are to me In particular, Andrea Hammer led me toward deeper insights into the cultural and historical implications of what I was trying...
Ngày tải lên: 21/09/2012, 11:00
Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"
... and the CA 19.9 marker as predictors [20] Sample size was taken into account [21] A first analysis was made on the “raw” data package The selection of variables was always backward In the variables ... criteria The assembly of the previous data package with a total of 93 records (53 cases and 40 controls) in DBase IV format was combined with the new data package in an EXCEL format and with a total ... neurology, allergy, and clinical pharmacology, and also family doctors in training o recycling periods The objectives of the investigation were explained to all participating physicians and they were provided...
Ngày tải lên: 03/11/2012, 11:34
Write Better Essays - Choosing a Topic and Developing a Thesis
... can we eliminate inequalities in the federal tax system? Tentative thesis: Instituting a flat tax will eliminate inequalities 45 – CHOOSING A TOPIC AND DEVELOPING A THESIS – Assignment: Write an ... CHOOSING A TOPIC AND DEVELOPING A THESIS – Practice For the following assignment, identify a broad topic, narrow it, and turn it into a question and tentative thesis Assignment: Identify a factor ... be drawn in by your lively prose and passionate assertions But what if you aren’t really interested in any of the ideas you came up with while brainstorming? What if the assignment is about a subject...
Ngày tải lên: 25/10/2013, 17:20
The revolution in philosophy (II) - autonomy and the moral order
... being agents at all. The “fact of reason” is another way of articulating the distinctively Kantian idea that reasons have a claim on us because we make them have a claim on us; in entertaining ... that capacity in each other, and this itself leads to a further specification of the categorical imperative, which Kant formulates as: “Act in such a way that you always treat humanity whether in ... on the other hand, human actors are fully responsible and fully capable of forming the supreme practical law of morality (the categorical imperative) and of forming and acting upon maxims that...
Ngày tải lên: 01/11/2013, 08:20