g protein signaling, methods and protocols

g protein signaling, methods and protocols

g protein signaling, methods and protocols

... Smrcka G Protein Signaling VOLUME 237 Methods and Protocols Edited by Alan V. Smrcka Methods and Protocols G Protein Signaling G Protein Subunit Purification from Sf9 Cells 21 21 From: Methods ... downstream effectors. GTP on G is hydrolyzed to GDP by its own GTPase activity as well as GTPase-activating proteins, such as regulator of G protein signaling (RGS) pr...

Ngày tải lên: 10/04/2014, 22:24

233 306 0
cancer cell signaling methods and protocols

cancer cell signaling methods and protocols

... Targeting Vectors 2.2.1. Cloning of Genomic DNA Coding a Target Gene A genomic DNA coding the gene of interest for constructing a targeting vec- tor is needed. A genomic library from the same ... the digestion with EcoRI and PstI, the wild-type allele shows 2670 bp band and the knockout allele shows 2430 bp. 3. Methods 3.1. Heterozygous Gene Targeting 3.1.1. Transfection of a Targeting...

Ngày tải lên: 10/04/2014, 11:11

291 445 1
protein arrays, methods and protocols

protein arrays, methods and protocols

... (His) 6 tag, followed by two stop codons, a poly (A) tail, and a transcrip- tion termination region (6). The DNA sequence is GCTCTAGAggcggtggctctggtg gcggttctggcggtggcaccggtggcggttctggcggtggcAAACGGGCTGATGC TGCACATCACCATCACCATCACTCTAGAGCTTGGCGTCACCCG CAGTTCGGTGGTCACCACCACCACCACCACTAATAA(A) 28 CCGCTGAGCAA TAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TGCTGAAAGGAGGAACTATATCCGGA-3'. .....

Ngày tải lên: 11/04/2014, 10:11

285 345 0
Glycoprotein Methods and Protocols - P2

Glycoprotein Methods and Protocols - P2

... of glycoproteins and glycolipids along cell membranes as well as those of secretory glycoproteins (mucins). They have been used as hemagglutinins and for stimulating lymphocyte transformation and ... removing sialic acid. This has been achieved for galactose using PNA and for GalNAc using Dolichos biflorus agglutinin (DBA) within normal and 32 Walsh and Jass diseased colon (20,21)...

Ngày tải lên: 08/10/2012, 10:25

16 705 0
Glycoprotein Methods and Protocols - P3

Glycoprotein Methods and Protocols - P3

... conjugated antibody against the primary antibody species and class) or conjugated directly with an enzyme (e .g. , HRP, AP), or a ligand for a secondary enzyme conjugate (e .g. , biotin, digoxigenin), or ... glycoforms, in Glycoprotein Methods and Protocols: The Mucins (Corfield, T., ed.), Humana, Totowa, NJ. 5. Kim, Y. S., Gum, J., and Brockhausen, I. (1996) Mucin glycoproteins in n...

Ngày tải lên: 08/10/2012, 10:25

11 572 0
w