g protein signaling, methods and protocols

... Smrcka G Protein Signaling VOLUME 237 Methods and Protocols Edited by Alan V. Smrcka Methods and Protocols G Protein Signaling G Protein Subunit Purification from Sf9 Cells 21 21 From: Methods ... downstream effectors. GTP on G is hydrolyzed to GDP by its own GTPase activity as well as GTPase-activating proteins, such as regulator of G protein signaling (RGS) pr...

Ngày tải lên: 10/04/2014, 22:24

... Targeting Vectors 2.2.1. Cloning of Genomic DNA Coding a Target Gene A genomic DNA coding the gene of interest for constructing a targeting vec- tor is needed. A genomic library from the same ... the digestion with EcoRI and PstI, the wild-type allele shows 2670 bp band and the knockout allele shows 2430 bp. 3. Methods 3.1. Heterozygous Gene Targeting 3.1.1. Transfection of a Targeting...

Ngày tải lên: 10/04/2014, 11:11

... (His) 6 tag, followed by two stop codons, a poly (A) tail, and a transcrip- tion termination region (6). The DNA sequence is GCTCTAGAggcggtggctctggtg gcggttctggcggtggcaccggtggcggttctggcggtggcAAACGGGCTGATGC TGCACATCACCATCACCATCACTCTAGAGCTTGGCGTCACCCG CAGTTCGGTGGTCACCACCACCACCACCACTAATAA(A) 28 CCGCTGAGCAA TAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TGCTGAAAGGAGGAACTATATCCGGA-3'. .....

Ngày tải lên: 11/04/2014, 10:11

... by Anthony P. Corfield The Mucins Glycoprotein Methods and Protocols Isolation of Large Gel-Forming Mucins 11 Fig. 1. Density gradient centrifugation of cervical mucins and DNA. Purified cervical mu- cins ... Mucin-type glycoproteins. Crit. Rev. Biochem. Mol. Biol. 27, 5792. Isolation of Large Gel-Forming Mucins 3 3 From: Methods in Molecular Biology, Vol. 125: Glycoprotein Methods...

Ngày tải lên: 08/10/2012, 10:25

... of glycoproteins and glycolipids along cell membranes as well as those of secretory glycoproteins (mucins). They have been used as hemagglutinins and for stimulating lymphocyte transformation and ... removing sialic acid. This has been achieved for galactose using PNA and for GalNAc using Dolichos biflorus agglutinin (DBA) within normal and 32 Walsh and Jass diseased colon (20,21)...

Ngày tải lên: 08/10/2012, 10:25

... conjugated antibody against the primary antibody species and class) or conjugated directly with an enzyme (e .g. , HRP, AP), or a ligand for a secondary enzyme conjugate (e .g. , biotin, digoxigenin), or ... glycoforms, in Glycoprotein Methods and Protocols: The Mucins (Corfield, T., ed.), Humana, Totowa, NJ. 5. Kim, Y. S., Gum, J., and Brockhausen, I. (1996) Mucin glycoproteins in n...

Ngày tải lên: 08/10/2012, 10:25

... mucous gel layer will be greatly reduced and discontinuous. 7. Careful handling of the cryostat sections on the slide during fixing and staining is impor- tant because excessive washing and so ... A., and Garner, A. (1982) A simple method for measuring thickness of the mucosal gel layer adherent to rat, frog and human gastric mucosa: influence of feeding prostaglandin, N-acetyl-cyst...

Ngày tải lên: 08/10/2012, 10:25

... Bio-Rad). 9. Trizol RNA isolation solution (Gibco/BRL, Gaithersburg, MD). 10. Agarose gel electrophoresis apparatus, and 0.8% (w/v) agarose gels. 11. Radiolabeled, homologous cDNA or cRNA probe to quantify ... (au)/milliliter of homogenate. 4. Identify and quantify the mature mucin band in the homogenate and medium after separation on reducing 4% SDS-PAGE using the PhosphorImager (see N...

Ngày tải lên: 08/10/2012, 10:25