functional analysis - k yoshida

Ngày tải lên: 31/03/2014, 15:14

... train anaphoric anaphoric anaphoric anaphoric anaphoric exophoric anaphoric anaphoric exophoric exophoric anaphoric anaphoric anaphoric anaphoric anaphoric anaphoric anaphoric exophoric exophoric anaphoric anaphoric anaphoric anaphoric 2-1 3-2 -1 4-3 - 2-1 5-4 - 3-2 -1 5-5 - 4-3 - 2-1 7-5 - 4-3 - 2-1 8-7 - 5-4 - 3-2 -1 9-8 -...

Ngày tải lên: 07/09/2013, 13:48

... với n = k, ta chứng minh nó đúng với n = k + 1. Ta có u ◦ v k+ 2 − v k+ 2 ◦ u = (u ◦ v k+ 1 )v − v(v k+ 1 ◦ u) = (v k+ 1 ◦ u + (k + 1)v k ) ◦ v − v k+ 2 ◦ u = v k+ 1 ◦ (u ◦ v) + (k + 1)v k+ 1 − v k+ 2 ◦ ... v k+ 1 ◦ (u ◦ v) + (k + 1)v k+ 1 − v k+ 2 ◦ u = v k+ 1 (id + v ◦ u) + (k + 1)v k+ 1 − v k+ 2 ◦ u = v k+ 1 + v k+ 2 ◦ u + (k + 1)v k+ 1 − v k+ 2 ◦ u = (k + 2)v...

Ngày tải lên: 21/09/2013, 15:11

... that f n k converges in L p . In order to simplify the notation we write f k instead of f n k ,so that we have (6) f k+ 1 − f k  p ≤ 1 2 k k ≥ 1. Let g n (x) = n  k= 1 |f k+ 1 (x) − f k (x)|, so ... an integer k ≥ 1 there is an integer N k such that f m − f n  ∞ ≤ 1 k for m, n ≥ N k . Hence there is a null set E k such that (5) |f m (x) − f n (x)|≤ 1 k ∀x ∈ \...

Ngày tải lên: 04/02/2014, 11:10

... – 21 – 20 – 18 – 16 – 7 – 3 33–32– 21– 21– 20– 18–16 – 7 – 3 35 – 13 – 11 3 6-3 3- 3 2- 2 1- 2 1- 2 0- 1 8- 1 6- 7- 3 Table 6 Table 7 Total number of reference: 44 Anaphoric reference: 29 ... (ellipsis) (ellipsis) both of them (ellipsis) unmarked unmarked unmarked unmarked unmarked unmarked unmarked marked unmarked ... Non-c...

Ngày tải lên: 12/02/2014, 20:20

... reporter assay. Western blot analysis Rabbit antibodies to DEC1 were produced by immun- izisation with the synthetic peptide fragment Cys-Lys- Gly-Asp-Leu-Arg-Ser-Glu-Gln-Pro-Tyr-Phe-Lys-Ser- Asp-His-Gly-Arg-Arg. The ... primers (5¢-CGGCAATTTGTAGGTCTCCTTGCTGTCCTCGC TC-3¢ and 5 - GCCCGGCTCATCGAGAAAAAGAGA CGTGACCGG-3¢ for DEC1-H57A; 5¢-GATGAGCCG GTGCGGCAATTTGTAGGTCTCC-3¢ and 5 ¢-GAGAA AAAG...

Ngày tải lên: 19/02/2014, 16:20

... presents ongoing work on DOP models for Lexical -Functional Grammar representations, known as LFG-DOP (Bod & Kaplan 1998). We develop a parser which uses fragments from LFG-annotated sentences ... of different sizes those that make up the most appropriate analysis of an utterance. DOP models have been shown to achieve state-of-the-art parsing performance on benchmarks such as the Wall...

Ngày tải lên: 20/02/2014, 18:20

... three Ig-like domains [24], while a 1 B-glycopro- tein is a five-Ig-like domain protein of 63 kDa [41]. Considering the results on amino acid sequence and molecularmassofDM64,DM43anda 1 B-glycoprotein, ... a-lactalbumin (14.4 kDa). Molecular mass DM64 molecular mass was determined by MALDI-TOF MS on a Voyager DE-PRO instrument (Perseptive Biosys- tems). The matrix used was 3,5-dimethoxy-4-hydr...

Ngày tải lên: 21/02/2014, 01:21

... p2 6-3 - 6-3 as template (Table 1). The cDNAs i nclude: p26-full, the full-length p26 cDNA; p26-ND36, lacks N-terminal residues 1–36; p26-ND60 , lacks N-terminal residues 1–60; p26-CD40, lacks C-termi- nal ... 468/156 (p2 6-1 92Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT p26-ND60 1–60 (p2 6-6 0Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 396/132 (p2 6-1 92Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCC...

Ngày tải lên: 22/02/2014, 04:20

... - 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0 66 - 45 - 31 - 20 - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRB FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRA FnBPA-1 FnBPA-2 FnBPA-3 FnBPA-4 FnBPA-5 FnBPA-6 FnBPA-7 FnBPA-8 FnBPA-9 FnBPA-10 FnBPA-11 GST FnBRA A 490 ... concentrations FnBRB kD...

Ngày tải lên: 06/03/2014, 22:21