Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

... NF -jB transactivation (Eur. J. Biochem. 271) 3751 RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator Toshifumi Tetsuka1, Hiroaki Uranishi1, Takaomi ... Medical Sciences, Nagoya, Aichi, Japan;2Department of Medicine, University of California San Diego, La Jolla, CA, USA RNA helicase A (RHA), a member of DNA and RNA helicase f amily containing ATPase ... maleless; MSL, male-speciﬁc lethal; NF -jB, nuclear factor jB; NIK, NF -jB inducing kinase; NLS, nuclear localizationsignal; RAI, RelA-associated inhibitor; RHA, RNA helicase A; RNA Pol II, RNA...

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

... 11444–11455.12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K,Takahashi M & Nakagawara A (2003) Function of p73,D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1FEBS Journal 273 (2006) ... Takahashi N (2004) Humanﬁbrillarin forms a sub-complex with splicing factor 2-associated p32, protein arginine methyltransferases, and tubulins alpha 3 and beta 1 that is independent ofits association ... negatively charged glycosaminogly-cans, such as chondroitin sulfate, heparan sulfate and RNA, although with lower afﬁnity, it was also namedintracellular hyaluronan binding protein 4 (IHABP4)Keywordscellular...

Báo cáo khoa học: Identiﬁcation of RNase HII from psychrotrophic bacterium, Shewanella sp. SIB1 as a high-activity type RNase H pot

... Bacterial RNases HI, eukaryotic RNases H1, and retroviral RNases H are members of the type 1RNase H family. Bacterial RNases HII, bacterialRNases HIII, archaeal RNases HII, and eukaryoticRNases ... eukaryoticRNases H2 are members of the type 2 RNase H family.According to the crystal structures of bacterialRNases HI [12–14], archaeal RNases HII [15–17], and bacterial RNase HIII [18], these RNases ... time at 35 °C and above for SIB1 RNase HII, and 40 °C and above forE. coli RNase HII (data not shown). These resultsindicate that SIB1 RNase HII and E. coli RNase HIIare not fully stable at...

Báo cáo khoa học: Comprehensive interaction of dicalcin with annexins in frog olfactory and respiratory cilia pdf

... were:5¢-GGAATTCCATATGTCATTCATTTCCGAG-3¢ (for-ward) and 5¢-CGGGATCCTTAAGCTCCTCCAATAAGTG-3¢ (reverse) for annexin A1 ; 5¢-CATATGGCTACTATTCATGAAAT-3¢ (forward) and 5¢-GGTTCCTCAGTCATCTCCAGCACATAG-3¢ ... for annexin A2 ; and 5¢-GGAATTCCATATGGCAACGACAAAAAG-3¢ (for-ward) and 5¢-CGGGATCCTTACTCATCATCCCCA-3¢(reverse) for annexin A5 . The NdeI- and BamHI-digestedcDNA was ligated with pET- 3a (Novagen, ... that dicalcin binds toannexin A1 , annexin A2 and annexin A5 , and that itfacilitates the membrane aggregation activities of ann-exin A1 and annexin A2 . In mammal S100 proteins and annexins, an...

Báo cáo khoa học: Biochemical characterization of rice trehalose-6-phosphate phosphatases supports distinctive functions of these plant enzymes potx

... Forward TCAGTCATGCCCGGTGGCReverse ACACTGAGTGCTTCTTCCOsTPP2 (AB277360) Forward ATGGATTTGAAGACAAGCAACReverse TTAAGTGGATTCCTCCTTCCAOsTPP3 (AP004341) Forward ATGACGAACCACGCCGGCReverse CTACTTGCCAATCAGCCCTTTOsTPP4 ... essen-tial for normal vegetative growth and transition to ﬂow-ering. Plant Physiol 135, 969–977.17 Satoh-Nagasawa N, Nagasawa N, Malcomber S, SakaiH & Jackson D (2006) A trehalose metabolic ... CTACTTGCCAATCAGCCCTTTOsTPP4 (AP004119) Forward CTGTTCGTCTCGACGAGTReverse TCTTACGGCCTCTACACCOsTPP5 (AL606633) Forward CACGCACCTACACCAAGAReverse TGATGGGCCTCTCAGCATOsTPP6 (AP004658) Forward TCAACGGATGGGTGGAGTReverse...

Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx

... Chantilly, VA). Data have been pre-sented here as lmolÆmin)1(per mg of total protein).Luciferase from plasmid pLUC was included as an internalcontrol in this assay, and statistical analysis ... using BSA as a standard. GUS activities were determined by ﬂuorometricassay using 1 mm 4-methylumbelliferyl B-d-glucuronide as substrate and 4-methylumbelliferone as standard, and assays were ... p35SHARepA alone; lane 3, extracts fromcells bombarded with both p35SHA6HISRep and p35SHARepAafter the ﬁrst wash; lane 4, after the second wash; lane 5, after thethird wash; and lane 6, after...

Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP speciﬁc phosphodiesterase (PDE5a1) potx

... SDS/PAGE.Caspase-3 activity assaysCaspase-3 activity in cell lysates was measured using[35S]methionine-labeled PARP as a substrate. In each assay,equal amounts of cell lysate protein ( 5 lg/assay)were ... [8].PDE 5A1 cleavage by caspase-3 and/ or caspase-3activated proteases in Cos-7 cell and PC12 cellsCos-7 cells were transiently transfected with PDE5 and/ orcaspase-3 plasmid constructs. The main ... that PDE 5A1 interacts with caspase-3 and indirectly with caspase-3-activated proteases was shownby results showing that the caspase-3/7 inhibitor,Ac-DEVD-CHO abolished the reduction in PDE 5A1 ...

Báo cáo khoa học: Autophosphorylation of heme-regulated eukaryotic initiation factor 2a kinase and the role of the modiﬁcation in catalysis doc

... phosphatase was purchased from New EnglandBiolabs Japan (Tokyo, Japan). Other reagents were pur-chased from Wako Pure Chemical Industries (Osaka,Japan). Reagents were of the highest commercial ... &Koromilas AE (2006) Tyrosine phosphorylation acts as a molecular switch to full-scale activation of the eIF 2a RNA- dependent protein kinase. Proc Natl Acad SciUSA 103, 63–68.14 Raﬁe-Kolpin M, Han A- P ... Coomassie staining of a SDS-acrylamide gel con-taining Phos-tag acrylamide and manganese.J. Igarashi et al. Autophosphorylation of an HRIFEBS Journal 278 (2011) 918–928 ª 2011 The Authors Journal compilation...

Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

... a- mannosidase tar-get RNA (RNA2 ) and free 5¢ exon target RNA (RNA3 ). M, RNA sizemarker.T. Fiskaa et al. RNA reprogramming of a- mannosidase mRNA sequencesFEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors ... (2001)Structural basis of the enhanced stability of a mutantribozyme domain and a detailed view of RNA solventinteractions. Structure 9, 221–234.T. Fiskaa et al. RNA reprogramming of a- mannosidase mRNA ... details. (B) Represen-tative results of the major RNA species(numbered 1–4) detected in RPA. RNA1 ,undigested probe; RNA2 , trans-spliced a- mannosidase mRNA; RNA3 , a- mannosi-dase target RNA; RNA4 ,...

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... s-DAPK-1Dtail was almost as active as full-length DAPK-1 (Fig. 4C). These data indicate that the‘tail’ of s-DAPK-1 has a negative regulatory function with regard to s-DAPK-1 activity, and that its ... expression of the mRNAs encompassingfull-length DAPK-1 and s-DAPK-1 in colorectal carci-nomas ( 1a) and their normal tissue counterpart ( 4a) using real-time PCR. As indicated, DAPK-1 and s-DAPK-1 seem ... (GAPDH) mRNA quantiﬁcation in coloncarcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts...

Xem thêm