Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

... NF -jB transactivation (Eur. J. Biochem. 271) 3751 RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator Toshifumi Tetsuka 1 , Hiroaki Uranishi 1 , Takaomi ... Medical Sciences, Nagoya, Aichi, Japan; 2 Department of Medicine, University of California San Diego, La Jolla, CA, USA RNA helicase A (RHA), a member...

Ngày tải lên: 30/03/2014, 15:20

... 11444–11455. 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (2003) Function of p73, D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1 FEBS Journal 273 (2006) ... Takahashi N (2004) Human fibrillarin forms a sub-complex with splicing factor 2-associated p32, protein arginine methyltransferases, and tubulins alpha 3 and beta 1 that...

Ngày tải lên: 16/03/2014, 13:20

... Bacterial RNases HI, eukaryotic RNases H1, and retroviral RNases H are members of the type 1 RNase H family. Bacterial RNases HII, bacterial RNases HIII, archaeal RNases HII, and eukaryotic RNases ... eukaryotic RNases H2 are members of the type 2 RNase H family. According to the crystal structures of bacterial RNases HI [12–14], archaeal RNases HII [15–17], and bacterial RNase HIII [18...

Ngày tải lên: 16/03/2014, 13:20

... were: 5¢-GGAATTCCATATGTCATTCATTTCCGAG-3¢ (for- ward) and 5¢-CGGGATCCTTAAGCTCCTCCAATAAGT G-3¢ (reverse) for annexin A1 ; 5¢-CATATGGCTACTATT CATGAAAT-3¢ (forward) and 5¢-GGTTCCTCAGTCA TCTCCAGCACATAG-3¢ ... for annexin A2 ; and 5¢-GGAATTCCATATGGCAACGACAAAAAG-3¢ (for- ward) and 5¢-CGGGATCCTTACTCATCATCCCCA-3¢ (reverse) for annexin A5 . The NdeI- and BamHI-digested cDNA was ligated wi...

Ngày tải lên: 07/03/2014, 05:20

... Forward TCAGTCATGCCCGGTGGC Reverse ACACTGAGTGCTTCTTCC OsTPP2 (AB277360) Forward ATGGATTTGAAGACAAGCAAC Reverse TTAAGTGGATTCCTCCTTCCA OsTPP3 (AP004341) Forward ATGACGAACCACGCCGGC Reverse CTACTTGCCAATCAGCCCTTT OsTPP4 ... essen- tial for normal vegetative growth and transition to flow- ering. Plant Physiol 135, 969–977. 17 Satoh-Nagasawa N, Nagasawa N, Malcomber S, Sakai H & Jackson D (2006)...

Ngày tải lên: 16/03/2014, 11:20

... Chantilly, VA). Data have been pre- sented here as lmolÆmin )1 (per mg of total protein). Luciferase from plasmid pLUC was included as an internal control in this assay, and statistical analysis ... using BSA as a standard. GUS activities were determined by fluorometric assay using 1 mm 4-methylumbelliferyl B-d-glucuronide as substrate and 4-methylumbelliferone as standard, an...

Ngày tải lên: 16/03/2014, 13:20

... SDS/PAGE. Caspase-3 activity assays Caspase-3 activity in cell lysates was measured using [ 35 S]methionine-labeled PARP as a substrate. In each assay, equal amounts of cell lysate protein ( 5 lg/assay) were ... [8]. PDE 5A1 cleavage by caspase-3 and/ or caspase-3 activated proteases in Cos-7 cell and PC12 cells Cos-7 cells were transiently transfected with PDE5 and/ or caspase-3 p...

Ngày tải lên: 17/03/2014, 09:20

... phosphatase was purchased from New England Biolabs Japan (Tokyo, Japan). Other reagents were pur- chased from Wako Pure Chemical Industries (Osaka, Japan). Reagents were of the highest commercial ... & Koromilas AE (2006) Tyrosine phosphorylation acts as a molecular switch to full-scale activation of the eIF 2a RNA- dependent protein kinase. Proc Natl Acad Sci USA 103, 63–68. 14 Rafi...

Ngày tải lên: 28/03/2014, 23:20

... a- mannosidase tar- get RNA (RNA2 ) and free 5¢ exon target RNA (RNA3 ). M, RNA size marker. T. Fiskaa et al. RNA reprogramming of a- mannosidase mRNA sequences FEBS Journal 273 (2006) 2789–2800 ª 2006 The Authors ... (2001) Structural basis of the enhanced stability of a mutant ribozyme domain and a detailed view of RNA solvent interactions. Structure 9, 221–234. T. Fiskaa...

Ngày tải lên: 23/03/2014, 11:20

... s-DAPK-1Dtail was almost as active as full- length DAPK-1 (Fig. 4C). These data indicate that the ‘tail’ of s-DAPK-1 has a negative regulatory function with regard to s-DAPK-1 activity, and that its ... expression of the mRNAs encompassing full-length DAPK-1 and s-DAPK-1 in colorectal carci- nomas ( 1a) and their normal tissue counterpart ( 4a) using real-time PCR. As indicat...

Ngày tải lên: 18/02/2014, 17:20