Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) potx

Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) Mhairi J. Frame 1 , Rothwelle Tate 1 , David R. Adams 2 , Keith M. Morgan 3 , M. D. Houslay 4 , Peter Vandenabeele 5 and Nigel J. Pyne 1 1 Department of Physiology and Pharmacology, Strathclyde Institute for Biomedical Sciences, University of Strathclyde, Glasgow, Scotland; 2 Department of Chemistry, Heriot-Watt University, Riccarton, Edinburgh, Scotland; 3 School of Textiles, Heriot-Watt University, Scottish Borders Campus, Galashiels, Scotland; 4 Molecular Pharmacology Group, Division of Biochemistry & Molecular Biology, Institute of Biological and Life Sciences, University of Glasgow, Scotland; 5 Department of Molecular Biology, Institute of Biotechnology, Flanders Interuniversity, University of Ghent, Belgium Here, we show that recombinant bovine PDE5A1 is pro- teolysed by recombinant caspase-3 in in vitro and transfected Cos-7 cells. In addition, the treatment of PDE5A1-trans- fected Cos-7 and PC12 cells with staurosporine, an apoptotic agent that activates endogenous caspase-3, also induced proteolysis and inactivation of PDE5A1. These findings suggest that there is specificity in the interaction between caspase-3 and PDE5A1 that requires application of an apoptotic stimulus. The potential proteolysis of the [778]DQGD[781] site in PDE5A1 by caspase-3 might affect cGMP’s hydrolyzing activity as this is within the boundary of the active site. We therefore created a truncated D781 mutant corresponding exactly to the potential cleavage product. This mutant was expressed equally well compared with the wild-type enzyme in transfected Cos-7 cells and was inactive. Inactivity of the truncated mutant was not due to potential misfolding of the enzyme as it eluted from gel filtration chromatography in the same fraction as the wild-type enzyme. Homology model comparison with the catalytic domain of PDE4B2 was used to probe a func- tional role for the region in PDE5A1 that might be cleaved by caspase-3. From this, we can predict that a caspase-3- mediated cleavage of the [778]DQGD[781] motif would result in removal of the C-terminal tail containing Q807 and F810, which are potentially important amino acids required for substrate binding. Keywords: apoptosis; caspases; cyclic GMP; phospho- diesterase; proteases. Members of the phosphodiesterase (PDE) family catalyze the hydrolysis of cyclic nucleotides to inactive 5¢ nucleotides. Therefore, they terminate the action of agents, such as b-adrenergic agonists and nitric oxide, which use cAMP and cGMP as Ôsecond-messengersÕ, respectively, to initiate cellular responses. There are at least 11 members of the PDE family (PDE1- 11) that are encoded by different genes. These isoforms have different specificities for cAMP and cGMP, are regulated by several different protein kinases, e.g. protein kinase A, protein kinase B (Akt pro-oncogene), extracellular signal- regulated kinase (ERK) and CAM kinase, and allosteric molecules (e.g. cyclic nucleotides, Ca 2+ ) and display distinct tissue distribution [1–3]. PDE5A1 is a major cGMP-binding protein expressed in lung [4] where it is believed to have a key role in regulating nitric oxide signaling. There are at least two isoforms (termed PDE5A1 and 2) [4]. The enzyme has a high- affinity for cGMP at both noncatalytic (GAF domains) and catalytic sites, is a dimeric protein with a subunit molecular mass of 93–98 kDa [5]. The enzyme is phosphorylated at S92 and activated by both protein kinase A and protein kinase G [6–7]. Here we explore the possibility that PDE5A1 may be regulated by caspase-3 as sequence inspection shows that the bovine enzyme contains five putative caspase consensus sites: DHWD(26–29), DEGD(134–137), DEKD(289–292), DCSD(365–368) and DQGD(778–781) (Fig. 1). Of these sites, only two show strong consensus for caspase-3: DHWD(26–29) and DQGD(778–781). Indeed, we have shown that in the presence of the inhibitory protein (PDEc) of the rod photoreceptor PDE6, PDE5A1 is a substrate for a low activity preparation of purified caspase-3 [8]. Site- directed mutagenesis studies have defined the position of the GAF domains [9–11] and key amino acid residues involved in the metal ion coordination and catalytic activity [12–15]. These are shown in Fig. 1 to define their relative position of the putative caspase sites. The caspase family is composed of 13 distinct gene products, each with different substrate preferences and inhibitor sensitivities [16]. The first caspase was identified as ICE (caspase-1), which converts pro-interleukin-1b into bioactive interleukin-1b [17]. Subsequently, several human and murine caspases have been cloned. These enzymes show sequence homology with CED-3 from the nematode, Caenorrhabdidtis elegans [18]. The overexpression of Correspondence to N. J. Pyne, Department of Physiology and Pharmacology, Strathclyde Institute for Biomedical Sciences, University of Strathclyde, 27 Taylor Street, Glasgow, G4 ONR, Scotland, UK. Fax: + 141 5522562, Tel.: + 141 5524400 ext 2659, E-mail: n.j.pyne@strath.ac.uk Abbreviations: DMEM, Dulbecco’s modified Eagle’s medium; PDE, phosphodiesterase; PARP, poly (ADP-ribose) polymerase. (Received 5 November 2002, revised 8 January 2003, accepted 16 January 2003) Eur. J. Biochem. 270, 962–970 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03464.x different caspases in cells induces apoptosis and/or inflam- matory mediator production [19,20]. Caspases are synthes- ized in the cell as inactive proenzymes. These are activated by proteolysis at internal sites and are subdivided into initiators and effector enzymes. Initiator caspases (e.g. caspase-8 and -9) are activated by proximity induced proteolysis by adaptor-dependent recruitment in the recep- tosome or apoptosome complex. Once activated, these will further propagate the cascade by activating the downstream effector caspases. The effector (executioner) enzymes include caspase-3, and proteolyse a number of substrates resulting in structural changes, such as gelsolin, nuclear changes such as ICAD and signal transduction such as MEK kinase [21], Mst-1 [22], PAK-2 [23], PI3K/Akt [24], PKCf [25] and FAK [26]. Caspase-3 and -7 cleave proteins at a 4 DX 3 X 2 D 1 consensus site, where apolar amino acids at position 2 are preferred. The cyclic nucleotides, cGMP and cAMP have been shown to promote apoptosis of certain mammalian cells. For instance, nitric oxide stimulates apoptosis in cardiomyocytes and endothelial cells via a cGMP-dependent pathway [27–29]. cGMP is also required for nerve cell death caused by glutathione depletion, via modulation of calcium channel activity [30]. In addition, Huston and colleagues have shown that PDE4A5, which specifically hydrolyses cAMP, is proteolysed by caspase-3. This removes the N-terminal tail that contains specific binding sites for the lyn kinase [31]. These findings provide a rationale for investigating whether caspase-mediated path- wayscaninteractwithPDE5inintactcells. In this article, we show that caspase-3 either directly or indirectly via caspase-3 activated proteases results in cleavage and inactivation of PDE5A1. Homology model comparison with the catalytic domain of PDE4B2 was used to probe a functional role for the region in PDE5A1 that might be cleaved by caspase-3. Residues in PDE5 identified by Turko and colleagues [13,14] H603, H607, H643, D644, E762, H675, T713, D754, Q765 and Q779 were used for the modeling. Mutations of T713 and H675 that are cognate residues of those that orientate the magnesium ion via H-bonds to water ligands in PDE4B produce comparatively little impact on catalytic activity in PDE5. From the modeling, it is possible that inactivation of PDE5A1 by caspase-3 might occur via removal of key regions which constitute part of the wall of the catalytic site of PDE5A1. We also suggest a possible interaction between PDE5A1 and an uniden- tified caspase-3-initiated protease(s) that may constitute a novel signaling event. Experimental procedures Materials All biochemicals were from Boehringer Mannheim (Mann- heim, Germany), while general chemicals and snake venom were from Sigma Chemical Co. (Poole, UK). [ 3 H]cGMP and [ 35 S]methionine were from Amersham International (Amersham, Buckinghamshire, UK). Cell culture supplies were from Life Technologies (Paisley, UK). Ac-DEVD- CHO and anti-PDE5 IgG was from Calbiochem (UK). The pCAGGS-Casp-3 plasmid construct was kindly provided by T. Miyazaki, The Burnham Institute, La Jolla, CA, USA. Protein purification Recombinant murine caspases were purified according to [19]. The proteolytic activity of these enzymes on procaspase substrates has been described previously [32]. Sub-cloning Bovine PDE5A1 cDNA (GenBank accession number L16545) in pBacPac9 (Clontech, CA, USA) was a gift from J. Corbin (Vanderbilt University, USA). It was subcloned into pcDNA3.1/Zeo(–) (Invitrogen, the Netherlands) by amplifying the ORF using primers ApaI-Koz-PDE5A1- FOR(AAGGGCCCGCCACCATGGAGAGGG CCG GCC CCG GCT) and XbaI-PDE5A1REV (GCT TCTAGACTCAGTTCCGCTTGGTCTGGCTGC TTT CAC), digesting the product and the vector with ApaI and XbaI (Promega, UK), ligating, and then transforming into TOP10 Escherichia coli (Invitrogen). Positive clones were selected and sequenced by BigDye terminator cycle sequencing (PE Biosystems, UK) using a PE373A auto- mated DNA sequencer. Site-directed mutagenesis of D781 (DfiA) in the caspase-3 consensus site was carried out using Stratagene’s QuikChange Mutagenesis kit (Stratagene, UK). This was achieved using pcDNA3.1-PDE5 Zeo(–) plasmid with 125 ng of the forward primer, PDE5MUTF (GAC CAA GGA GCT AGA GAG AGG AAA GAA CTC) and the reverse primer, PDE5MUTR (GAG TTC TTT CCT CTC TCT AGC TCC TTG GTC) in a 50-lL PCR containing 50 ng of pcDNA3.1-PDE5 Zeo(–) plasmid, 10 m M KCl, 10 m M (NH 4 ) 2 SO 4 ,20m M Tris/HCl (pH 8.8), 2 m M MgSO 4 ,0.1%TritonX-100,0.5lg bovine serum albumin, 0.4 m M dNTPs and 2.5 U PfuTurbo DNA polymerase. The cycling conditions were 95 °C for 30 s then 12 cycles of 95 °C for 30 s, 55 °C for 1 min and 68 °C for 15 min. Ten units of DpnI restriction enzyme was added to the reaction following PCR. Two microliters of reaction mixture was used in a transformation reaction with TOP10 competent E. coli. Positive clones were selected and sequenced to confirm the mutagenesis. Truncation of PDE5A1 at D781 involved the use of primers that carry a single point mutation to introduce a premature stop codon at 782R. The forward primer has the sequence GAC CAA GGA GAT TGA GAG AGG AAA GAA CTC, while the reverse primer was GAG TTC TTT CCT CTC TCA ATC TCC TTG GTC. Twelve cycles of Fig. 1. Schematic showing the positions of caspase motifs in PDE5A1. Ó FEBS 2003 Interaction of caspase-3 with PDE5A1 (Eur. J. Biochem. 270) 963 95 °C for 30 s, 55 °C for 1 min and 68 °C for 16 min were used for the PCR. Transfection Cos-7 cells or PC12 cells were grown to 50–70% confluence in Dulbecco’s modified Eagle’s medium (DMEM) contain- ing 10% (v/v) fetal bovine serum. Five micrograms of pcDNA-3.1-PDE5 or 0.1–1 lgofpCAGGS-Casp-3was added to DMEM and DEAE-dextran (10 mgÆmL )1 ), mixed thoroughly and incubated at room temperature for 15 min. Cells were incubated at 37 °C for 1 h with this medium, before this was removed and 1 mL of 10% (v/v) dimethyl- sulfoxide added for 30 s. The medium was then aspirated and the cells washed twice with DMEM containing 10% (v/v) fetal bovine serum.The cells werethenplacedinDMEM containing 10% (v/v) fetal bovine serum, grown to conflu- ence and harvested 48 h after transfection. Alternatively, cells were transfected with the plasmid construct following complex formation with LipofectAMINE TM 2000, accord- ing to the manufacturer’s instructions. The cDNA contain- ing media was then removed following incubation for 24 h at 37 °C, and the cells incubated for a further 24 h. Cell lysates Cos-7 and PC12 cell lysates were prepared by adding 0.25 M sucrose, 1 m M EDTA, 10 m M Tris/HCl, pH 7.4, 2 m M benzamidine and 0.1 m M phenylmethanesulfonyl fluoride. Cells were scraped into this buffer and homogenized by passing through a 0.24-mm gauge syringe needle. The lysates were either used for caspase activity assays or combined with boiling electrophoresis sample buffer for SDS/PAGE. Immunoblotting Nitrocellulose membranes were blocked for 1 h at 4 °C in 10 m M phosphate-buffered saline (NaCl/P i ) and 0.1% (v/v) Tween-20 containing 5% (w/v) non fat dried milk and 0.001% (w/v) thimerisol. The nitrocellulose sheets were then incubated overnight at 4 °C with antibodies in blocking solution. The sheets were then washed with NaCl/P i and 0.1%(v/v) Tween-20 prior to incubation with horseradish peroxidase-linked anti-rabbit IgGs in blocking solution for 2 h at room temperature. After washing the blots as above, the immunoreactive bands were detected using an enhanced chemiluminescence kit. PDE assay Unless otherwise stated, the assay of PDE activity was by the two-step radiotracer method [33] using 0.5 l M [ 3 H]cGMP. PDE activity measurements were performed under condi- tions of linear rate product formation and where less than 10% of the substrate was utilized during the assay. [ 35 S]Methionine-labeled PDE5A1 and poly (ADP-ribose) polymerase (PARP) One microgram of pcDNA-3.1-PDE5 or pGEM-PARP was combined with an in vitro transcription/translation kit reaction (Promega, UK) to produce [ 35 S]methionine-labeled proteins. Purified caspases [ 35 S]Methionine-labeled PDE5A1 was combined with an incubation mix (25 lL) containing 50 m M Hepes, pH 7.4, 1m M EDTA and 10 m M dithiothreitol with 60 ng per assay purified recombinant murine caspases. Incubations were for 2 h at 30 °C and were terminated by addition of boiling sample buffer for SDS/PAGE. Caspase-3 activity assays Caspase-3 activity in cell lysates was measured using [ 35 S]methionine-labeled PARP as a substrate. In each assay, equal amounts of cell lysate protein ( 5 lg/assay) were used and incubated with PARP for 2 h at 30 °C. Incubations were terminated by addition of boiling electro- phoresis sample buffer for SDS/PAGE. Inhibition of caspase-3 activity was achieved using the reversible inhibitor acetyl-Asp(OMe)-Glu(OMe)-Val-Asp(OMe)-aldehyde (Ac-DEVD-CHO). Molecular modeling Modeling studies were performed on an SGI Octane workstation using the automated homology-modeling program, MODELER ,within INSIGHTII (Accelerys Inc., San Diego, CA, USA). This program generates an all-atom model based on a specified sequence alignment and reference protein structure. The crystal structure of the PDE4B2B core catalytic domain published by Xu et al. [34] was used as a reference model (Protein Data Bank accession code 1FOJ, chain B). A truncated PDE5A1 sequence, corresponding to the region spanning helices 5–16 of the 1FOJ structure, was matched to the PDE4B2 sequence. This region embodies the metal ion and substrate-binding pocket together with flanking helices and exhibits close homology to the PDE5A1 sequence (27% identity). Thirty models were generated using the program’s highest optimization level of molecular dynamics simulated annealing, and the model with the lowest overall probability density function violation was taken forward for further energy minimi- zation. Key residues in the PDE5A1 model that contribute to the metal binding environment (H603, H607, H643, D644, E672, H675, T713, D754) overlaid the corresponding residues in the PDE4B2 reference structure (H234, H238, H274, D275, E304, H307, T345 and D392) with little deviation. The coordinates of these residues and the a-carbon centers of Q765, Q779 and Q807 were frozen during subsequent minimization, which was carried out using the cvff forcefield imple- mented in the DISCOVER module of INSIGHTII .The dielectric constant was set to 4.00 and the model refined through 3000 steps of steepest descent energy minimiza- tion followed by conjugate gradient energy minimization to convergence with a 0.001 kcalÆmol )1 ÆA ˚ )1 root mean square energy gradient difference between successive minimization steps. 964 M. J. Frame et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Results and discussion Proteolysis of PDE5A1 by caspase-3 Recombinant PDE5A1 was produced from a pcDNA-1- PDE5 plasmid construct (which has a T7 polymerase initiation site) using an in vitro reticulocyte transcription/ translation kit. A major 98 kDa [ 35 S]methionine-labeled protein corresponding to PDE5A1 was produced from the plasmid construct and resolved on SDS/PAGE (Fig. 2). Several minor lower molecular mass [ 35 S]methionine-labeled proteins were also produced in the transcription and translation reaction. These are probably derived by differ- ential internal translation initiation or proteolysis of PDE5A1 by reticulocyte proteases. Figure 2 shows that caspase-3 cleaved PDE5A1 to a major 82 kDa fragment. This in vitro reaction showed specificity for caspase-3 because caspase-2, -12 and -14 did not significantly cleave the enzyme. Consensus sites for caspase-2, -12 and -14 are not present in PDE5A1. Assays were deliberately designed such that the final concentration of caspase-3 in the incubation was 40 n M , which is equivalent with its concen- tration in mammalian cells [32]. These conditions were used to best predict the extent and nature of the proteolysis that might occur in intact cells. Higher concentrations of caspase-3 or extended incubation times cause extensive proteolysis of the 82 kDa fragment into smaller polypep- tides and is therefore, less stringent. Caspase-3 cleaved  50% of the PDE5A1 under the assay conditions used. Proteolysis is dependent upon both the specific activity of the caspase-3, which might be limiting, and the affinity of interaction, which in vitro may reflect reduced efficiency compared with in vivo.The findings show that PDE5A1 is a substrate for caspase-3 in vitro, consistent with the presence of consensus caspase-3 sites in PDE5A1. They also support our previous results showing that PDE5A1 is proteolysed by low activity purified caspase-3 in the presence of PDEc [8]. PDE5A1 cleavage by caspase-3 and/or caspase-3 activated proteases in Cos-7 cell and PC12 cells Cos-7 cells were transiently transfected with PDE5 and/or caspase-3 plasmid constructs. The main objective here was to establish whether the overexpression of recombinant caspase-3 induces the proteolysis of PDE5A1 in an intact cell system. cGMP hydrolysing activity was increased 10- to 20-fold in PDE5A1-transfected vs. mock-transfected cells (n > 20), and was inhibited by > 90% by addition of the selective PDE5 inhibitor, zaprinast (10 l M ) to the assay. A major 98 kDa protein was detected on Western blots probed with specific anti-PDE5 IgGs in lysates from PDE5A1-transfect- ed but not mock-transfected cells and which comigrated with recombinant PDE5A1 (see later). These results are Fig. 2. The effect of recombinant caspases on PDE5A1. Autoradio- graph showing the effect of purified caspase-2, 3, 12 and 14 (60 ngÆassay )1 )on[ 35 S]methionine PDE5A1. Control represents no addition to PDE5A1. Radioactive-labeled molecular mass standards are shown (M r ¼ 200–33 kDa). This is a representative result of three separate experiments. Fig. 3. Caspase-3 in transfected Cos-7 cells. Cells were transfected with pCAGGS-Casp-3 cDNA (1 lg) and/or wild-type pcDNA-3.1-PDE-5 (5 lg). (A) Western blot probed with anti-caspase-3 antibodies showing the expression of recombinant caspase-3 in pCAGGS- Casp-3-transfected cells. (B) Autoradiograph showing the effect of Ac-DEVD-CHO (100 l M ) (added at the time of transfection) and recombinant PDE5A1 on caspase-3 activity in Cos-7 cells. Caspase-3 activity was measured using [ 35 S]methionine-labeled PARP as a sub- strate. These are representative results of three experiments. C3 denotes caspase-3. Ó FEBS 2003 Interaction of caspase-3 with PDE5A1 (Eur. J. Biochem. 270) 965 consistent with previous reports showing expression of functionally active recombinant PDE5 in Cos-7 cells [6]. Western blot analysis with anti-caspase-3 IgG confirmed expression of recombinant caspase-3 in pCAGGS-Casp-3- transfected cells. Figure 3A shows that the antibody reacted with five polypeptides of molecular mass corres- ponding to 35, 30, 17, 12 and 9 kDa in lysates from caspase-3-transfected cells. These proteins were not detected in lysates from mock-transfected cells. These polypeptide fragments are formed from auto-processing of the protease. Internal cleavage of native protein results in the formation of p17 and p12, which are catalytically active toward endogenous protein substrates. The formation of p9 might be due to extensive cleavage of intermediate fragments, as a result of particularly good overexpression of the enzyme in Cos-7 cells. Cotransfection of PDE5A1 did not affect the auto-activation of caspase-3. Caspase-3 activity in cell lysates was also measured using [ 35 S]methionine-labeled PARP (M r ¼ 115 kDa) as a substrate. Figure 3B shows that there is substantial endogenous caspase-3 activity in lysates from mock-transfected cell, possibility activated as a consequence of stressing cells during the transfection procedure. In the current study, endogenous caspase-3 activity converted  70% of the 115 kDa PARP to an 85- kDa fragment (p85). The overexpression of recombinant caspase-3 in Cos-7 cells resulted in more extensive proteo- lysis of the exogenous 115 kDa PARP in the assay (Fig. 3B). Caspase-3 activity was completely abolished by treatment of the cells with the caspase-3/7 inhibitor, Ac-DEVD-CHO (added at the time of transfection with caspase-3 plasmid construct). Overexpression of PDE5A1 did not inhibit the auto-activation of caspase-3 (Fig. 3B). This is in line with results showing that PDE5A1 did not affect auto-proteolysis of caspase-3 (Fig. 3A). We investigated the effect of overexpressing recombinant caspase-3 on PDE5A1 in transfected Cos-7 cells. 98 kDa PDE5A1 levels were markedly reduced by  60–75% in lysates of cells cotransfected with caspase 3 and PDE5A1 plasmid constructs (Fig. 4A,B). This is consistent with depletion of the enzyme via caspase-3-mediated cleavage. An 82-kDa fragment appeared only in lysates of cells overexpressing both enzymes (Fig. 4A,B). No other frag- ments were detected on Western blots. The accumulation of 82 kDa fragment was not correlated with a similar reduc- tion in the native 98 kDa PDE5A1 level. The most likely hypothesis is that caspase-3 proteolyses PDE5A1 as it is expressed and that the 82 kDa fragment thus formed, is then immediately processed further. In addition, caspase-3 may act on other proteases that cleave PDE5A1. This in itself is a potentially important and interesting finding as it might suggest a hitherto unidentified caspase-3 initiated protease cascade regulating PDE5A1 activity. Fig. 4. The interaction of caspase-3 with PDE5A1 in Cos-7 cells. Cells were transfected with pCAGGS-Casp-3 cDNA (1 lg) and/or wild- type or truncated D781 pcDNA-3.1-PDE5 (5 lg) plasmid constructs. (A) Western blot probed with anti-PDE5 IgG showing the effect of Ac-DEVD-CHO (100 l M ) on the cleavage of PDE5A1 by caspase-3 in transfected Cos-7 cells. The position of the truncated D781 mutant on SDS/PAGE expressed in Cos-7 cells is also shown; (B) Western blot probed with anti-PDE5 IgG showing the proteolysis of wild-type PDE5A1 by recombinant caspase-3 in transfected Cos-7 cells to reveal the faster migrating 82 kDa fragment. These are representative results of at least three separate experiments. C3 denotes caspase-3. Fig. 5. Changes in activity of PDE5A1 upon cleavage by caspase-3. Cells were transfected with pCAGGS-Casp-3 cDNA (0.1–1 lg) and/or wild-type or truncated D781 pcDNA-3.1-PDE5 (5 lg) plasmid con- structs. The histogram shows the effect of overexpressing recombinant caspase-3 and the treatment of cells with Ac-DEVD-CHO (100 l M )on wild-type recombinant PDE5A1 activity in Cos-7 cells. PDE5A1 activity was measured at 0.5 l M [ 3 H]cGMP. Results are expressed as the fold increase over basal PDE activity in mock-transfected cells. D781 truncated PDE5A1 was expressed as an inactive enzyme. Inset is the corresponding Western blot showing 98 kDa PDE5A1 levels. The 82 kDa fragment is not evident as the Western blot is underexposed to better demonstrate the increase in 98 kDa PDE5A1 in Ac-DEVD- CHO-treated cells. In the latter case, cells were transfected with pCAGGS-Casp-3 cDNA (1 lg) and wild-type or truncated D781 pcDNA-3.1-PDE5 (5 lg) plasmid constructs. These are representative results of at least three separate experiments. C3 denotes caspase-3. 966 M. J. Frame et al. (Eur. J. Biochem. 270) Ó FEBS 2003 The reduction in 98 kDa PDE5A1 levels was correlated with a decrease in PDE5A1 activity (Fig. 5). The remaining PDE activity in caspase-3/PDE5A1 transfected cells was recovered by gel filtration on Superose 12 with a similar elution compared with PDE5A1 from cells overexpressing this enzyme alone (Fig. 6). Further evidence to support the possibility that PDE5A1 interacts with caspase-3 and indirectly with caspase-3-activated proteases was shown by results showing that the caspase-3/7 inhibitor, Ac-DEVD-CHO abolished the reduction in PDE5A1 levels observed in cells cotransfected with PDE5A1 and caspase-3 (Fig. 4A). This was correlated with the reversal of the reduction in cGMP hydrolysing PDE activity (Fig. 5). It is interesting to note that the treatment of cells with Ac-DEVD-CHO appeared to increase 98 kDa PDE5A1 levels and activity above controls, consistent with an action of endogenous caspase-3/7 (Figs 4A and 5). It remains to be determined which of the potential caspase sites is cleaved to inactivate the enzyme. However, only two sites exhibit strong consensus for caspase-3 26 DHWD 29 and 778 DQGD 781 . Cleavage at 78 DQGD 781 would produce an 82-kDa fragment. We cannot ascertain at the moment whether cleavage at 78 DQGD 781 causes inactivation, as there is no correlation in the reduction in 98 kDa protein levels with the appearance of the 82 kDa fragment. Importantly, as the overexpression of caspase-3 in Cos-7 cells induces cell death [32], we conclude from the current findings that cleavage and inactivation of PDE5A1 medi- ated by caspase-3 may be associated with this process. However, further studies are necessary to establish whether the cleavage of PDE5A1 is a key event governing cell death. To demonstrate the robustness of the interaction between caspase-3 and PDE5A1, we repeated the experiments in PC12 cells. In contrast with Cos-7 cells, the treatment of PC12 cells with Ac-DEVD-CHO did not modulate the expression level of recombinant PDE5A1 (Fig. 7A), indi- cating that endogenous caspase-3 activity is not a factor that might influence the native state of recombinant PDE5A1 in this case. However, in common with Cos-7 cells, Fig. 7. Effect of caspase-3 and staurosporine on PDE5A1 proteolysis. Cells were transfected with pCAGGS-Casp-3 cDNA (1 lg) and/or wild-type pcDNA-3.1-PDE5 (5 lg) plasmid constructs. Cells stimu- lated with and without staurosporine (10 l M , 24 h) were transfected only with wild-type pcDNA-3.1-PDE5 (5 lg) plasmid construct. (A) Western blot probed with anti-PDE5 IgG showing the proteolysis of wild-type PDE5A1 by recombinant caspase-3 (and the effect of Ac-DEVD-CHO (100 l M ) added at the time of transfection) and in response to staurosporine in PC12 cells. Also shown is a histogram of the corresponding reduction in PDE5A1 activity. (B) Western blot probed with anti-PDE5 IgG showing the proteolysis of wild-type PDE5A1 in Cos-7 cells stimulated with staurosporine. Also shown is a histogram of the corresponding reduction in PDE5A1 activity. All activities were measured using samples equalized for protein. PDE5A1 activity was measured at 0.5 l M [ 3 H]cGMP. These are representative results of at least 2–4 separate experiments. C3 denotes caspase-3. Fig. 6. Elution of PDE5A1 from Superose-12. Cells were transfected with pCAGGS-Casp-3 cDNA (1 lg) and/or wild-type or truncated D781 pcDNA-3.1-PDE5 (5 lg) plasmid constructs. The figure shows Western blots of chromatographic fractions eluted from Superose 12 probed with anti-PDE5 IgG and a PDE5A1 activity profile (taken from high-speed supernatants of cells overexpressing caspase-3/ PDE5A1). Total elution volume was 35 mL, with 1-mL fractions. These are representative results of at least three separate experiments. Ó FEBS 2003 Interaction of caspase-3 with PDE5A1 (Eur. J. Biochem. 270) 967 overexpression of recombinant caspase-3, results in the reduction of 98 kDa PDE5A1 levels, concomitant with a similar decrease in cGMP PDE activity (Fig. 7A). The effect of the apoptotic agent, staurosporine We also investigated whether apoptotic agents induce the cleavage of PDE5A1. For this purpose we used, staurosporine (PKC inhibitor), which has been shown by Brophy et al. [35] to activate caspase-3 activity in Cos-7 cells. Figure 7A,B shows that the treatment of PDE5A1- transfected Cos-7 and PC12 cells, respectively, with stauro- sporine caused a marked reduction in 98 kDa PDE5A1 levels and PDE activity. These findings suggest that there is specificity in the interaction between caspase-3 and PDE5A1 that requires application of an apoptotic stimulus. DQGD(778–781) site Proteolysis of the DQGD(778–781) by caspase-3 might affect catalytic activity of PDE5A1 as the site is within the boundary of the active site. In addition, cleavage at this site would produce an 82-kDa fragment. To test whether a potential cleavage of the DQGD(778–781) site might affect catalytic activity of PDE5A1, we created a truncated D781 mutant corresponding exactly to the 82 kDa fragment. This mutant was expressed equally well compared with the wild- type enzyme in transfected Cos-7 cells, comigrated with the 82 kDa fragment formed from the cleavage of PDE5A1 in cells cotransfected with caspase-3 (Fig. 4A) and was inactive (Fig. 5). Inactivation of the truncated mutant was no due to potential misfolding of the enzyme. This was shown by results showing that the truncated mutant eluted from Superose 12 at the same position compared with the wild- type enzyme (Fig. 6), suggesting similar hydrodynamic properties. The inactivity of the truncated mutant provides indirect support for the possibility that cleavage of DQGD(778–781) is one potential mechanism that might lead to inactivation of PDE5A1 activity. In this regard, we found that a more subtle change in PDE5A1 using a single point mutation at D781 (replaced with A) also results in a reduction of PDE activity. The D781A mutant partial loss of PDE5A1 activity to  70% of the wild type measured at 0.5 l M cGMP. The reduction in PDE activity was due, in part, to an increase in the K m for cGMP. The K m for the wild-type enzyme was 2.2 l M compared with 8.4 l M for the D781A mutant. The kinetic constants were determined in samples where the expression level of the D781 mutant PDE5A1 mg )1 cell lysate protein was approximately twice that of the wild-type enzyme. Assays were normalized for protein. From this data, we calculated that the mutant PDE5A1 exhibits a V max that is approximately 50% of the wild-type enzyme. These findings are in agreement with studies by Turko et al. [14], who reported identical changes in the kinetic constants of the D781A mutant. The DQGD site is within the boundary of the catalytic domain of PDE5A1 (Fig. 1). We have used the X-ray crystal structure of PDE4B2 [34] as a template to generate a homology model for PDE5A1 to rationalize the structural implications of a caspase-3-catalyzed proteolysis at the PDE5A1 DQGD(778–781) site. From the PDE5 Fig. 8. PDE5 homology model. Homology model of PDE5A1 based on PDE4B2 crystal structure showing how the removal of the C-terminal tail containing Q807 and F810 by caspase-3 affects the architecture of the cata- lytic site, and in particular interaction with Q765. 968 M. J. Frame et al. (Eur. J. Biochem. 270) Ó FEBS 2003 homology model, proteolytic cleavage at DQGD(778–781) in PDE5A1 might be expected to remove the C-terminal tail (highlighted in yellow in Fig. 8) containing Q807 and F810, which are potentially important amino acids required for substrate binding. Q807 is completely conserved across the PDE superfamily and, in principle, might accept either the guanine base of cGMP or the adenine base of cAMP. F810 in PDE5A1 is conserved in PDE4B2 as F446, and this residue has been shown by site-directed mutagenesis to be essential for catalytic competence in PDE4 and to play a key role in the binding of competitive PDE4 inhibitors [36]. The side chain of this residue may conceivably p-stack with the purine base of the bound substrate and form hydrophobic interactions with a number of inhibitors. In PDE4B2 the sequence QQGD(416–419), corresponding to the PDE5A1 caspase-3 site DQGD(778–781) is identical, except that the site is disabled by replacement of D for Q at the P4 position. The site is located on the exposed C-terminal end of helix 14 in the PDE4B2 crystal structure. In conclusion, the caspase- 3-catalyzed cleavage at DQGD(778–781) in PDE5A1 will very likely remove a key wall from the catalytic site containing Q807/F810. This might prevent potential inter- action with critical adjacent amino acid residues present on the other side of the catalytic pocket, identified by Turko and colleagues, such as Q765 [13]. The removal of part of the catalytic pocket explains the inactivity of the engine- ered protein truncated at D781. Potential cleavage at DQGD(778–781) by caspase-3 could severely disrupt the structure of PDE5A1. Interestingly, there is substantial similarity between the amino acid sequence of the PDE5A1 DQGD(778–781) site and the corresponding region in PDE2A3,PDE4C,PDE4D,PDE6ab and PDE11A1. D778 at P4 of the caspase-3 consensus site in PDE5A1 is replaced withEinPDE11A1andPDE6ab, Q in PDE4C, R in PDE4D and S in PDE2A3. Therefore, the replacement of the 4 D effectively disables the caspase-3 site in these PDE isoforms. Summary The results presented in this article are consistent with PDE5A1 acting as a substrate for caspase-3 in intact cells. In addition, PDE5A1 may be subject to cleavage by a caspase- 3-initiated protease(s) event. These results raise the possi- bility of a role for PDE5A1 in apoptosis. However, further investigation is required to establish a causal linkage between PDE5A1 cleavage and apoptosis. Acknowledgments This study was supported by the BBSRC. References 1. Beavo, J.A. (1995) Cyclic nucleotide phosphodiesterases: functional implications of multiple isoforms. Physiol. Rev. 75, 725–748. 2. Beavo, J.A. & Brunton, L.L. (2002) Cyclic nucleotide research – still expanding after half a century. Nat. Rev. Mol. Cell. Biol. 3 (9), 710–718. 3. Houslay, M.D. & Adams, D.R. (2003) PDE4 cAMP phos- phodiesterases: modular enzymes that orchestrate signalling cross-talk, desensitisation and compartmentalisation. Biochem. J. 370, 1–18. 4. Corbin, J.D. & Francis, S.H. (1999) Cyclic GMP phosphodies- terase-5: target of sildenafil. J. Biol. Chem. 274, 13729–13732. 5. McAllister-Lucas, L.M., Sonnenburg, W.K., Kadlecek, A., Seger, D., Trong, H.L., Colbran, J.L., Thomas, M.K., Walsh, K.A., Francis, S.H., Corbin, J.D. & Beavo, J. (1993) The structure of a bovine lung cGMP-binding, cGMP-specific phos- phodiesterase deduced from a cDNA clone. J. Biol. Chem. 268, 22863–22873. 6. Thomas, M.K., Francis, S.H. & Corbin, J. (1990) Characteriza- tion of a purified bovine lung cGMP-binding cGMP phospho- diesterase. J. Biol. Chem. 265, 14964–14970. 7. Burns, F., Rodger, I.W. & Pyne, N.J. (1992) The catalytic subunit of protein kinase A triggers activation of the type V cyclic GMP- specific phosphodiesterase from guinea-pig lung. Biochem. J. 283, 487–491. 8. Frame, M., Wan, K F., Tate, R., Vandenabeele, P. & Pyne, N.J. (2001) The gamma subunit of the rod photoreceptor cGMP phosphodiesterase can modulate the proteolysis of two cGMP binding cGMP-specific phosphodiesterases (PDE6 and PDE5) by caspase-3. Cell. Signal. 13, 735–741. 9. Aravind, L. & Ponting, C.P. (1997) The GAF domain: an evolu- tionary link between diverse phototransducing proteins. Trends Biochem. Sci. 22, 458–459. 10. Ho, Y.S., Burden, L.M. & Hurley, J.H. (2000) Structure of the GAF domain, a ubiquitous signaling motif and a new class of cyclic GMP receptor. EMBO J. 19, 5288–5299. 11. Martinez, S.E., Wu, A.Y., Glavas, N.A., Tang, X.B., Turley, S., Hol, W.G. & Beavo, J.A. (2002) The two GAF domains in phosphodiesterase 2A have distinct roles in dimerization and in cGMP binding. Proc. Natl. Acad. Sci. USA 99, 13260–13265. 12. McAllister-Lucas, L.M., Haik, T.L., Colbran, J.L., Sonnenburg, W.K., Seger, D., Turko, I.V., Beavo, J.A., Francis, S.H. & Corbin, J.D. (1998) An essential aspartic acid at each of two allosteric cGMP-binding sites of a cGMP-specific phosphodiesterase. J. Biol. Chem. 270, 30671–30679. 13. Turko, I.V., Francis, S.H. & Corbin, J.D. (1998) Hydropathic analysis and mutagenesis of the catalytic domain of the cGMP- binding cGMP-specific phosphodiesterase (PDE5). cGMP versus cAMP substrate selectivity. Biochemistry 37, 4200–4205. 14. Turko, I.V., Francis, S.H. & Corbin, J.D. (1998) Potential roles of conserved amino acids in the catalytic domain of the cGMP- binding cGMP-specific phosphodiesterase. J. Biol. Chem. 273, 6460–6466. 15. Francis,S.H.,Turko,I.V.,Grimes,K.A.&Corbin,J.D.(2000) Histidine-607 and histidine-643 provide important interactions for metal support of catalysis in phosphodiesterase-5. Biochemistry 39, 9591–9596. 16. Nunez, G., Benedict, M.A., Hu, Y.M. & Inohara, N. (1998) Caspases: the proteases of the apoptotic pathway. Oncogene 17, 3237–3245. 17. Alnemri, E.S., Fernandes-Alnemri, T. & Litwack, G. (1995) Cloning and expression of four novel isoforms of human inter- leukin-1 beta converting enzyme with different apoptotic activities. J. Biol. Chem. 270, 4312–4317. 18. Hengartner, M.O., Ells, R.E. & Horvitz, H.R. (1992) Caenor- habditis elegans gene ced-9 protects cells from programmed cell death. Nature 356, 494–499. 19. Van De Craen, M., Vandenabeele, P., Declercq, W., Van Den Brande, I., Van Loo, G., Molemans, F., Schotte, P., Van Criek- inge, W., Beyaert, R. & Friers, W. (1997) Characterization of seven murine caspase family members. FEBS Lett. 403, 61–69. 20. Van De Craen, M., Declercq, W., Van Den Brande, I., Friers, W. & Vandenabeele, P. (1999) The proteolytic procaspase activation network: an in vitro analysis. Cell Death Differ. 11, 1117–1124. Ó FEBS 2003 Interaction of caspase-3 with PDE5A1 (Eur. J. Biochem. 270) 969 21. Cardone, M.H., Salvesen, G.S., Widmann, C., Johnson, G. & Frisch, S.M. (1997) The regulation of anoikis: MEKK-1 activa- tion requires cleavage by caspases. Cell 90, 315–323. 22. Graves, J.D., Gotoh, Y., Draves, K.E., Ambrose, D., Han, D.K., Wright, M., Chernoff. J., Clark, E.A. & Krebs, E.G. (1998) Cas- pase-mediated activation and induction of apoptosis by the mammalian Ste20-like kinase Mst1. EMBO J. 17, 2224–2234. 23. Rudel, T. & Bokoch, G.M. (1997) Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activa- tion of PAK2. Science 276, 1571–1574. 24. Francois, F. & Grimes, M.L. (1999) Phosphorylation-dependent Akt cleavage in neural cell in vitro reconstitution of apoptosis. J. Neurochem. 73, 1773–1776. 25. Frutos, S., Moscat, J. & Diaz-Meco, M.T. (1999) Cleavage of zetaPKC but not lambda/iotaPKC by caspase-3 during UV- induced apoptosis. J. Biol. Chem. 274, 10765–10770. 26. Van de Water, B., Nagelkerke, J.F. & Stevens, J.L. (1999) Dephosphorylation of focal adhesion kinase (FAK) and loss of focal contacts precede caspase-mediated cleavage of FAK during apoptosis in renal epithelial cells. J. Biol. Chem. 274, 13328–13337. 27. Baixeras, E., Garcia-Lozano, E. & Martinez, A C. (1996) Decrease in cAMP levels promoted by CD48–CD2 interaction correlates with inhibition of apoptosis in B cells. Scan.J.Immunol. 43, 406–412. 28. Tortorella, C., Piazzolla, G., Spaccavento, F. & Antonaci, S. (1998) Effects of granulocyte-macrophage colony-stimulating factor and cyclic AMP interaction on human neutrophil apopto- sis. Med. Inflamm. 7, 391–396. 29. Shimojo, T., Hiroe, M., Ishiyama, S., Ito, H., Nishikawa, T. & Marumo, F. (1999) Nitric oxide induces apoptotic death of cardiomyocytes via a cyclic-GMP-dependent pathway. Exp. Cell. Res. 247, 38–47. 30. Li. Y., Maher, P. & Schubert, D. (1997) Requirement for cGMP in nerve cell death caused by glutathione depletion. J. Cell. Biol. 139, 1317–1324. 31. Huston, E., Beard, M., McCallum, F., Pyne, N.J., Vandenabeele, P., Scotland, G. & Houslay, M.D. (2000) The cAMP-specific phosphodiesterase PDE4A5 is cleaved downstream of its SH3 interaction domain by caspase-3. Consequences for altered intracellular distribution. J. Biol. Chem. 275, 28063–28074. 32. Stennicke, H.R., Jurgansmeier, J.M., Shin, H., Deveraux, Q., Wolf, B.B., Yang, X., Zhou, Q., Ellerby, H.M., Bredesen, D., Green, D.R., Froelich, C.J. & Salvesen, G.S. (1998) Pro-caspase-3 is a major physiologic target of caspase-8. J. Biol. Chem. 273, 27084–27090. 33. Thompson, J. & Appleman, M. (1971) Multiple cyclic nucleotide phosphodiesterase activities from rat brain. Biochemistry 10, 311– 316. 34. Xu, R.Y., Hassell, A.M., Vanderwall, D., Lambert, M.H., Hol- mes, W.D., Luther, M.A., Rocque, W.J., Milburn, M.U., Zhao, Y., Ke, H. & Nolte, R.T. (2000) Atomic structure of PDE4: insights into phosphodiesterase mechanism and specificity. Science 288, 1822–1825. 35. Brophy, V.A., Tavare, J.M. & Rivett, A.J. (2002) Treatment of COS-7 cells with proteasome inhibitors or gamma-interferon reduces the increase in caspase 3 activity associated with staurosporine-induced apoptosis. Arch. Biochem. Biophys. 397, 199–205. 36. Richter, W., Unciuleac, L., Hermsdorf, T., Kronbach, T. & Dettmer, D. (2001) Identification of inhibitor binding sites of the cAMP-specific phosphodiesterase 4. Cell. Signall. 13, 287–297. 970 M. J. Frame et al. (Eur. J. Biochem. 270) Ó FEBS 2003 . Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) Mhairi J. Frame 1 , Rothwelle. N.J. (2001) The gamma subunit of the rod photoreceptor cGMP phosphodiesterase can modulate the proteolysis of two cGMP binding cGMP -specific phosphodiesterases