A Slave is a Slave pot
A Slave is a Slave pot
... profit. Everybody knew that—except here on Aditya. On Aditya, a slave worked because he was a slave, and a Master provided for him because he was a Master, and that was all there was to it. But now, ... simply can't imagine anybody not being either a slave or a slave- owner," Erskyll was saying. "That must mean that there is no free non -slave- holding class...
Ngày tải lên: 29/03/2014, 16:20
Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf
... sense disambiguated, vastly multilingual dictionary called PANDIC- TIONARY (Mausam et al., 2009). PANDIC- TIONARY is automatically constructed by prob- abilistic inference over a graph of translations, which ... dictionary is 0.9 (evaluated based on a random sample). PANDIC- TIONARY has about 80,000 senses and about 1.8 million translations at precision 0.9. We use Google Image Search...
Ngày tải lên: 08/03/2014, 01:20
A Filbert Is a Nut ppt
... safe distance, a few hundred yards away. At 5:30 a. m., a plane landed at a nearby airfield and a platoon of Atomic Energy Commission experts, military intelligence men, four FBI agents and an Army ... sighed happily and laid down his palette. At the clay table, Funston feverishly fabricated the last odd-shaped bit of clay and slapped it into place. With a furtive glance around him...
Ngày tải lên: 29/03/2014, 14:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral ... the manufac- turer’s procedure (Clontech, CA). Briefly, mouse Vgf cDNA (Salton, unpublished data) was isolated via Xba I-Apa I restriction cleavage, and cloned into the NheI-ApaI sites o...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately ... predict that an anti- body raised to a sequence outside this domain might have little effect on the RAP assay signal. This was tested with an antibody to nucleolin raised against amino acids...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 ... TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA Ub Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTG...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of the vacuolar hydrolases of Sac- charomyces cerevisiae. ... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phyto- toxic protein from Cera...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot
... S., Watanabe ,A. ,Iriguchi,M.,Ishikawa ,A. ,Kawashima,K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M. & Tabata, S. (2001) Complete ... constants. Data were analyzed using the programs LAMM [25,26], SEDFIT 8.3 [27] and ULTRASCAN 5.0. RESULTS Analytical ultracentrifugation The c...
Ngày tải lên: 08/03/2014, 10:20
Deal Coaching is a Lost Art Smashwords Edition Author: Peter Bourke pot
... at worst! Isn’t this what sales managers are paid to do? Is there a better use of their available time? Is deal strategy that difficult to implement and sustain? Answering these questions and ... effective and efficient opportunity (“deal”) strategy and coaching. It’s harder than you might guess to find a sales team that does a great job of deal coaching. This reality is illo...
Ngày tải lên: 08/03/2014, 15:20