na k atpase acts as a sodium potassium pump

... TCAAGTGCATGTCC-3′, and for RPL7 were 5′-AAGA AGCGAATTGCTTTGAC-3′ and 5′-CAAATCCTCCAT GCAGATGA-3′ Wound healing assay Cell migration was measured by a wound healing assay × 105 Ishikawa and HEC 1A cells were ... Health, USA) Cell migration rate was converted to a percentage that measured the area compared to directly after the scratch Invasion assay For the transwell invasion assay, Ishikawa and HEC 1A ... Republic of Korea (to J.Y.Y.) and Grant Number P50CA098258 from the National Cancer Institute (to R.R.B and T.H .K. ) Availability of data and materials The raw data available upon reasonable request

Ngày tải lên: 17/06/2020, 17:19

... Uruguay 8Present Address: Departamento de Diagnóstico y Tratamientos Especiales, Dirección Nacional de Sanidad de las Fuerzas Armadas, Hospital Central de las Fuerzas Armadas, Montevideo, Uruguay ... RNAs” [8] The “vault” RNAs (vtRNAs) are a class of 84-141 nt long eukaryotic RNAs, that are transcribed by RNA polymerase III They associate with conserved vault proteins forming the vault particle, ... methylation in the metastatic stage of PrCa, we analyzed its status in normal prostates from organ donors and PrCa metastases in a rapid autopsy cohort of lethal metastatic PrCa available at the

Ngày tải lên: 24/07/2020, 00:42

... revealed that MALAT-1 acted as an oncogenic lncRNA in carcinoma of pancreas, and regulated CSC marker expression MALAT-1 also increases ratio of pancreatic CSCs and multidrug resistance, maintains ... 44 Imai T, Tokunaga A, Yoshida T, Hashimoto M, Mikoshiba K, Weinmaster G, et al The neural RNA-binding protein Musashi1 Translationally regulates mammalian numb gene expression by interacting ... s, and °C for After 300 μL Luria-Bertani medium was added, the mixture was shaked at 220 rpm for h Finally, transformants were transferred to kanamycin-containing plates at 37 °C overnight Kanamycin-resistant

Ngày tải lên: 06/08/2020, 04:42

... colorectal cancer Hidekazu Takahashi1†, Masanobu Takahashi1,2*†, Shinobu Ohnuma3, Michiaki Unno3, Yuki Yoshino1, Kota Ouchi1, Shin Takahashi1,2, Yasuhide Yamada4, Hideki Shimodaira1,2 and Chikashi ... 5-gctgcaggactctaatccaga, SNAI1 reverse; Takahashi et al BMC Cancer (2017) 17:723 5-gctgcaggactctaatccaga, SNAI2 forward; 5-tggttgcttcaag gacacat, SNAI2 reverse; 5-gttgcagtgagggcaagaa, GAPDH forward; 5-acccagaagactgtggatgg, ... Anti-EGFR therapy Background RAF family kinases, including BRAF and RAF1, function downstream of RAS as critical regulators of the MEK-ERK MAP kinase signaling pathway [1] This RAS-RAF-MEKERK

Ngày tải lên: 06/08/2020, 04:45

... 12 13 14 15 Acknowledgements We thank Tobias Ma and Anna Löhr for technical assistance as well as Gregor Klaus for helpful discussions We especially want to thank Roland Schüle and Manfred Jung ... Cancer J Int Cancer 2009;124:1778–84 26 Suda K, Murakami I, Katayama T, Tomizawa K, Osada H, Sekido Y, et al Reciprocal and Complementary Role of MET Amplification and EGFR T790M Mutation in Acquired ... and NCI-H460 (ATCC, American Type culture collection, Manassas, VA; USA; DSMZ, Braunschweig, Germany) with different histological properties as well as EGFR and KRAS mutational status were cultured

Ngày tải lên: 22/09/2020, 23:01

... non-coding RNAs and long noncoding RNAs depending on their length Long noncoding RNAs (lncRNAs) are defined as non-coding RNAs of more than 200 nucleotides in length, and are characterized by ... human diseases, the mechanism through which they contribute to cancer development is still largely unknown LncRNAs can regulate critical cancer pathways at a transcriptional, post-transcriptional ... MA, USA) The lncRNA expression profile of each sample was examined using a lncRNA expression microarray (SurePrint Human Gene Expression Microarray Kit, Agilent technologies, Santa Clara, CA,

Ngày tải lên: 30/09/2020, 13:12

... that blocking Na+ /K+ -ATPase has two direct and marked impacts on the cellular ionic homeostasis: increased intracellular Na+ concentration and decreased intracellular K+ concentration The majority ... significantly increased activation of caspase-3 and caspase-9 (Figure 2) The activation of caspases was also detected using Western blot analysis (Figure 2C to E) Maximal activation of both caspases-3 ... All the primers were designed to amplify products that covered one or more exons Na+ /K+ -ATPase á1 forward 5′-GAA AGA AGT TTC TAT GGA TG-3′ reverse 5′-ATG ATT ACA ACG GCT GAT AG-3′ Na+ /K+ -ATPase

Ngày tải lên: 14/10/2020, 16:12

... molecular dynamics simulation study of ameltolide analogous as a sodium channel blocker Maryam IMAN1 , Atefeh SAADABADI2 , Asghar DAVOOD2,∗ Chemical Injuries Research Center, Baqiyatallah University ... AutoDock with AutoDocktools: a tutorial La Jolla, CA, USA: The Scripps Research Institute, Molecular Graphics Laboratory; 2008, pp 54–56 23 Davood, A. ; Nematollahi, A. ; Iman, M.; Shafiee, A Arch ... semiempirical molecular orbital calculations (PM ) by utilizing the software HyperChem Total energy gradient was assessed using the Polak–Ribiere (conjugate gradient) algorithm as a root mean square

Ngày tải lên: 12/01/2022, 23:33

... GFP lacZ MyoIAts, puc-lacZ g Raw-RNAi ATF3-RNAi#1 – + – – + UAS-Raw – – + – + Raw-RNAi – – – + – Figure | ATF3 transcriptionally regulates Raw to restricts JNK activity (a) ChIP-seq track for ATF3-GFP ... the JNK-pathway components Kayak (kay; D-fos) and Puckered (puc; Jun kinase phosphatase) ATF3::EGFP a a″ a? ?? b e GFP Rel ATF3 expression Dl,pros DAPI b′ f b″ Rel ATF3 expression GFP Dl,pros DAPI ... signalling has a complex function in tissue homeostasis The puckered (puc) gene is a target of JNK signalling that encodes a JNK phosphatase and thereby mediates a negative feedback loop regulating

Ngày tải lên: 19/11/2022, 11:38

... supported that LncRNA acted as a diagnostic marker or therapeutic target in diseases For example, LncRNA H19 acted as a carcinogenic gene and was involved in gastric cancer [10], colorectal cancer ... Nottingham,L .K. ,etal.,AberrantIKKalphaandIKKbetacooperativelyactivateNFͲkappaBand induce EGFR/AP1 signaling to promote survival and migration of head and neck cancer. ... Reporter Assay System (Promega) Statistical analysis All data were presented as means ± SD SPSS 18.0 was used for data analysis Statistical differences were carried out by using of one-way analysis

Ngày tải lên: 04/12/2022, 15:14

... inhibition of cardiac Na+ , K+ -ATPase (NKA), the integral membrane protein that maintains ionic gradients in all superior eukaryotic cells1 The natural CTS include cardenolides and bufadienolides, known ... cardiac Na+ , K+ -ATPase (NKA) Bufadienolides constitute one of the two major classes of CTS, but little is known about how they interact with NKA We report a remarkable stereoselectivity of NKA inhibition ... requirements for Na+ , K+ -ATPase inhibition by cardiotonic steroids Hong-Jin Tang1,*, Li-Jun Ruan1,*, Hai-Yan Tian1, Guang-Ping Liang1, Wen-Cai Ye1, Eleri Hughes2, Mikael Esmann3, Natalya U. Fedosova3, Tse-Yu Chung4,

Ngày tải lên: 04/12/2022, 15:49

... CAAGTGCACGTTTGAAGGGTGCCGGAAGTCATACTCACGCCTCGAAAACCTGAAGACGCACCTGCGGTCA CACACGGGTGAGAAGCCATACATGTGTGAGCACGAGGGCTGCAGTAAAGCCTTCAGCAATGCCAGTGACC GAGCCAAGCACCAGAATCGGACCCATTCCAATGAGAAGCCGTATGTATGTAAGCTCCCTGGCTGCACCAA ACGCTATACAGATCCTAGCTCGCTGCGAAAACATGTCAAGACAGTGCATGGTCCTGACGCCCATGTGACC ... TGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCC CTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGC ATTTCCTAAGGGGTTTCTATCCTTCCAGAAAAATTGGGGGAGCTGCAGTCCCATGCACAAGATGCCCCAG GGATGGGAGGTATGGGCTGGGGGCTATGTATAGTCTGTATACGTTTTGAGGAGAAATTTGATAATGACAC ... CACATCAACAGCGAGCACATCCACGGGGAGCGGAAGGAGTTCGTGTGCCACTGGGGGGGCTGCTCCAGGG AGCTGAGGCCCTTCAAAGCCCAGTACATGCTGGTGGTTCACATGCGCAGACACACTGGCGAGAAGCCACA CAAGTGCACGTTTGAAGGGTGCCGGAAGTCATACTCACGCCTCGAAAACCTGAAGACGCACCTGCGGTCA

Ngày tải lên: 10/09/2015, 15:50

... VIETNAM NATIONAL UNIVERSITY, HANOI VIETNAM JAPAN UNIVERSITY - PHAM THI DUNG TWO-DIMENSIONAL NaxSiS AS A PROMISING ANODE MATERIAL FOR RECHARGEABLE SODIUM- BASED BATTERIES: AB ... degree of Master at Nanotechnology Program, Vietnam Japan University This work has been carried out in the Nanotechnology program, Vietnam Japan University, Vietnam National University of Hanoi I ... MATERIAL DESIGN MASTER'S THESIS Hanoi, 2018 VIETNAM NATIONAL UNIVERSITY, HANOI VIETNAM JAPAN UNIVERSITY PHAM THI DUNG TWO-DIMENSIONAL NaxSiS AS A PROMISING ANODE MATERIAL

Ngày tải lên: 17/03/2021, 08:58

... an estimated functional relationship between a response variable and a set of design variables It is a collection of mathematical and statistical techniques that are useful for modeling and analyzing ... usually complex and had low purity Bismut and Plas discovered the antitumor, antiviral, antibacterial, and immunomodulator biological activities of glucose phosphate derivatives, as well as their ... was stored for 30 and then vacuum filtrated The sediment was discarded, and the filtrate was adjusted to pH by addition of saturated sodium hydroxide solution The filtrate was stored for h, and

Ngày tải lên: 12/01/2022, 22:51

... Renugadevi, R.; Venkatachalam, T.; Narayanasamy, R.; Kirupha S D Optik 2016, 127, 10127-10134 17 Kajitvichyanukul, P.; Amornchat, P Sci Technol Adv Mat 2005, 6, 344-347 18 Arconada, N.; Castro, ... /multiwalled carbon nanotube composites and their use as a photocatalyst ¨ UM ¨ 1,∗, G¨ Alp YUR urkan KARAKAS ¸2 ˙ Sabancı University Nanotechnology Research and Application Center, Istanbul, Turkey ... thermal oxidative stability of CNTs by reducing the 451 ă UM ă and KARAKAS YUR /Turk J Chem activation energy and increasing the pre-exponential factor and surface area As a result, CNTs can be

Ngày tải lên: 13/01/2022, 00:25

... Psychologies: An International Analysis." International Journal of Psychology, 41: 24368 Bakan, David 1967 On Method: Toward a Reconstruction of Psychological Investigation San Francisco: Jossey-Bass, Danziger, ... based on historical thinking than philosophical reflection Strong objectivity includes an analysis of background beliefs that shape research and a combination of the micro as well as macro aspects ... Methodik, edited by Karl H Braun and Klaus Holzkamp, 17-37 Marburg Campus Horkheimer, Max 1992 "Traditional and Critical Theory." In Critical Theory: The Essential Readings, edited by D Ingram and

Ngày tải lên: 12/10/2022, 11:51

... wake up to the agreeable sensation of getting my penis massaged! But somehow I knew it wasn’t so A more ominous explanation came to my mind Maybe everything was real, and it was taken for granted ... my own… Admiration There was something like admiration in him as he moved his torch up and down that naked body Admiration and even something like awe Was he awed because she was dead, by the mystery ... pulse and shook his head As I was watching from above, they shone a flashlight straight into one of my eyes, but nothing happened The man who had taken my pulse turned away, took a few steps away

Ngày tải lên: 07/11/2012, 09:08

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢ The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...

Ngày tải lên: 18/02/2014, 16:20

... energy transduction in Na+ /K+ -ATPase In Na/ K- ATPase and Related ATPases (Taniguchi, K & Kaya, S., eds), pp 349356 Elsevier Science, Amsterdam 19 Toyoshima, C., Nakasako, M., Nomura, H & Ogawa, H ... p-nitrophenylphosphatase as a partial activity of Na+ /K+ ATPase was measured as described previously [17] Statistical analysis of the comparison of the phosphatase activities in truncated H4-H5 loop was carried ... sulfhydryl-reactive 8-thiocyano-ATP forming a mixed disulde bridge may inactivate Na+ /K+ ATPase [63] In the H4-H5 loop model of Na+ /K+ ATPase [20] obtained analogously to E1-Ca2+ ATPase [19], F548 is part...

Ngày tải lên: 19/02/2014, 16:20

... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a ... costimulation of phospholipases such as PLC and PLA2 by heat shock and the resultant release of lipid mediators could also enhance the subsequent membrane association and activation of protein kinase ... Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was used to compare...

Ngày tải lên: 07/03/2014, 12:20