RUNX3 acts as an ocogene through a hedgehog dependent pathway in selected human neoplasms

RUNX3 ACTS AS AN ONCOGENE THROUGH A HEDGEHOG-DEPENDENT PATHWAY IN SELECTED HUMAN NEOPLASMS PEH BEE KEOW (B.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF PATHOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2011 ACKNOWLEDGEMENTS My gratitude goes to my supervisor, A/Prof. Manuel Salto-Tellez for his patient guidance and support throughout my Ph.D. study. I thank Prof Yoshiaki Ito for his kind advice and support. I also thank the Oncology Research Institute, currently known as Cancer Science Institute, and the Department of Pathology for supporting my Ph.D. work throughout. My sincere appreciation also goes to all my fellow colleagues and friends at CSI: Mei Xian, Ti Ling, Tada-san, Chee Wee, Sandy, Weiyi, Victor, Dawn, Norlizan, Feroz and Suhaimi, especially TK and Dominic for their kind assistance and constructive advice along my Ph.D. journey. I thank them for their friendship. I would also like to thank Dr Chan Shing Leng and Eileen, for their patience and guidance through my animal work. Many thanks also to the CSI administrative team (Selena, Deborah and Siew Hong) and the Department of Pathology administrative team (Rohana and Adeline) for their kind help. Last but not least, I would like to specially thank my fiancé, Teck Meng for his constant moral support and encouragement to make my Ph.D. journey a possible one. Endless gratitude also goes to my beloved parents and family members for their patience, support, understanding and constant encouragement. Thank you! Peh Bee Keow i TABLE OF CONTENTS PAGE ACKNOWLEDGEMENTS i TABLE OF CONTENTS ii SUMMARY vi LIST OF TABLES viii LIST OF FIGURES ix LIST OF ABBREVATIONS xi CHAPTER INTRODUCTION 1. Hedgehog Pathway 1.1.1 Hedgehog signaling pathway 1.1.2 SHH signaling pathway is dependent on primary cilium in mammals 1.1.3 SHH signaling pathway during carcinogenesis 1.1.3.1 Genetics of basal cell carcinoma 1.1.3.2 Genetics of medulloblastoma 11 1.1.4 SHH-based therapeutics 1.2 RUNX3 14 16 1.2.1 RUNX protein family 16 1.2.1.1 Nomenclature of RUNX 18 1.2.1.2 Evolutionary conservation of RUNX 20 1.2.2 Role of RUNX protein family 21 1.2.2.1 RUNX1 22 1.2.2.2 RUNX2 22 1.2.2.3 RUNX3 23 1.2.3 Gain or loss of RUNX genes in cancer 23 1.2.4 RUNX3 and TGF-β tumor suppressor pathway 26 1.2.5 RUNX3 therapeutics 28 ii CHAPTER HYPOTHESIS 30 2.1 Original hypothesis: Preliminary data leading to the focus of this thesis 30 2.2 Subsequent hypothesis: Core of the thesis 30 CHAPTER MATERIALS AND METHODS 32 3.1 Materials 32 3.1.1 Primers 32 3.1.2 Commercial kit 35 3.1.3 Antibodies 36 3.1.4 General buffer preparation 36 3.2 Methods 39 3.2.1 Collection and processing of human tissue samples 39 3.2.1.1 Human cancer specimens 39 3.2.1.2 Tissue microarray construction 40 3.2.2 Microscopy technique 3.2.2.1 Immunohistochemistry (IHC) 3.2.3 Cell lines and cell culture 3.2.3.1 Treatment of cells by cyclopamine 43 43 44 45 3.2.4 Sequencing of RUNX3 coding exons 46 3.2.5 siRNA transient transfection 47 3.2.6 Quantitative real-time PCR analysis 47 3.2.7 Protein isolation 48 3.2.8 SDS-PAGE and western blot analysis 49 3.2.9 Immunoprecipitation 49 3.2.10 Methylation-specific PCR 50 3.2.11 Promoter assay 50 3.2.11.1 Cloning of GLI1 promoter 50 3.2.11.2 Dual-luciferase reporter assay 51 3.2.12 Stable knockdown of RUNX3 3.2.12.1 Generation of lentiviruses 53 53 iii 3.2.12.2 Lentiviral infection 55 3.2.13 MTS assay 56 3.2.14 Measurement of cell viability 56 3.2.15 Invasion assay and anchorage-independent growth assay in soft agar 56 3.2.16 Xenografts in NOD/SCID mice 57 3.2.17 Chromatin immunoprecipitation (ChIP) 57 3.2.18 Statistical analysis 58 CHAPTER RESULTS 59 4.1 RUNX3-SHH at a protein level: Is RUNX3 protein overexpression related to SHH signaling? 59 4.1.1 Expression of RUNX3 in different skin malignancies 59 4.1.2 Expression of RUNX3 in normal skin and BCC 63 4.1.3 Expression of RUNX3 in medulloblastoma 65 4.1.4 Expression of β-catenin in normal skin and BCC 67 4.1.5 Western blot analysis of RUNX3 protein expression in normal and BCC cell lines 69 4.1.6 Western blot analysis of RUNX3 protein expression in medulloblastoma cell lines 70 4.2 RUNX3-SHH: gene expression, methylation and sequencing evidence 71 4.2.1 Results of gene expression analysis in BCC clinical samples 72 4.2.2 Results of mRNA gene expression in cell lines 74 4.2.3 RUNX3 mutation screening 76 4.2.3.1 Sequencing 76 4.2.3.2 RUNX3 methylation 76 4.3 In SHH-related neoplasms, RUNX3 acts as an oncogene 79 4.3.1 Effects of stable knockdown of RUNX3 79 4.3.2 Soft agar assay 82 4.3.3 Nude mice assay 83 4.4 The RUNX3-SHH interaction is at the level of GLI1 85 4.4.1 Regulation of RUNX3 by cyclopamine 85 iv 4.4.2 RUNX3 interacts with GLI1 in HTB-186 cells in vitro 87 4.4.3 RUNX consensus binding sequences in GLI1 promoter 87 4.4.4 RUNX3 is recruited to the binding sites on the promoters of GLI1 89 4.4.5 Promoter assay 90 CHAPTER DISCUSSIONS 91 CHAPTER CONCLUSIONS AND FUTURE PERSPECTIVE 99 REFERENCES 100 APPENDICES Appendix pGL3 VECTOR FOR CLONING OF PROMOTER 115 Appendix pRL-SV40 VECTOR 116 Appendix HUMAN RUNX3 cDNA 117 Appendix HUMAN GLI1 cDNA 118 Appendix SEQUENCE OF HUMAN GLI1 PROMOTER (1000 bp) 119 Appendix pLKO.1 LENTIVIRAL VECTOR 120 v SUMMARY RUNX3 is a cellular transcription factor and, as such is active in the nucleus (Katinka et al 1980, Tanaka et al 1982). In all adult solid cancers analyzed before the start of our work, RUNX3 acts as a tumor suppressor gene (Bae and Choi 2004) (downregulation is associated with tumorigenesis). RUNX3 is frequently inactivated by dual mechanisms of protein mislocalization (Ito et al 2005) and promoter hypermethylation (Kim et al 2005). Since RUNX3 is a relatively new gene discovered in the 1990s, its different roles in human pathology are not fully explored. Hence, I explored the effect of RUNX3 overexpression in Sonic Hedgehog (SHH) - related neoplasms. Through my screening, RUNX3 was up-regulated and active in basal cell carcinoma and desmoplastic medulloblastoma. Although SHH has a minimal role in most adult tissues, it is known to be activated in basal cell carcinoma (Botchkarev and Fessing 2005) and medulloblastoma (Goodrich et al 1997). Silencing of RUNX3 with lentiviral shRNAs reduced cell proliferation and tumorigenesis in vitro and in vivo. In nude mice experiments, knockdown of endogenous RUNX3 in desmoplastic medulloblastoma cells significantly suppress tumorigenicity in nude mice. GLI1 was immunoprecipitated with RUNX3, indicating that endogenous RUNX3 interacts with endogenous GLI1 of the SHH signaling pathway. There are four RUNX consensus binding sequences in GLI1 promoter. Chromatin immunoprecipitation assay showed that RUNX3 is bound to the cognate RUNX3 binding site in the promoter region of GLI1. Altogether, these results showed that RUNX3 has an oncogenic activity in basal cell carcinoma and desmoplastic medulloblastoma. For the first time, GLI1 was identified vi as a novel downstream target of RUNX3 in the SHH signaling pathway. Strong evidence showed that RUNX3 transcriptionally regulates the expression of GLI1. vii LIST OF TABLES PAGE Table List of representative SHH target genes Table Mechanisms of SHH signaling activation during carcinogenesis Table Mutations in the SHH signaling pathway in BCCs 10 Table Mutations in the SHH signaling pathway in medulloblastomas 14 Table A selection of SHH targeted therapeutics 15 Table The mammalian RUNX genes synonyms and their locus 19 Table RUNX3 in human cancers 26 Table List of dermatological malignancies in the DermPath-Array 42 Table List of conditions used for immunohistochemistry 44 Table 10 List of dermatological malignancies screened for RUNX3 61 viii LIST OF FIGURES PAGE Figure SHH signaling pathway (Athar et al 2006). Figure SHH signaling in primary cilium (Caro and Low 2010). Figure The role of SHH in cerebellar development (Raffel 2004). 13 Figure Crystal structure of the Runt domain (Ito 2004). 18 Figure A diagrammatic representation of Drosophila Runt, RUNX1, RUNX2 and RUNX3 (Ito 2004). 21 Figure A schematic diagram of the transcription regulation by RUNX3 under the TGF-β tumor suppressor pathway (Ito and Miyazono 2003). 28 Figure Tumor array construction (Kononen et al 1998). 41 Figure The inhibition of SMO by cyclopamine in the SHH signaling pathway (Athar et al 2006). 45 Figure Structure and sequence characteristics of RUNX3 (Bangsow et al 2001). 46 Figure 10 Format of the dual-luciferase reporter assay. 52 Figure 11 Lentiviral particles are packaged in producer cell lines. 54 Figure 12 Schematic protocol for subcutaneous injection of RUNX3 knockdown cell lines into NOD/SCID mice with lentiviral-mediated gene transfer. 55 Figure 13 Nude mice assay with RUNX3 knockdown cell lines. 57 Figure 14 Immunohistochemical detection of RUNX3 expression in different skin malignancies tissue samples with antiRUNX3 monoclonal antibody R3-6E9. 62 Figure 15 Immunohistochemical detection of RUNX3 expression on skin tissue samples with anti-RUNX3 monoclonal antibody R3-6E9. 64 Figure 16 Immunohistochemistry for RUNX3 on conventional and desmoplastic medulloblastoma samples. 66 Figure 17 Immunohistochemistry for β-catenin on normal and BCC samples. 68 ix Jones PA, Laird PW (1999). Cancer epigenetics comes of age. Nat Genet 21: 163-167. Kagoshima H, Shigesada K, Satake M, Ito Y, Miyoshi H, Ohki M et al (1993). The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet 9: 338-341. Kagoshima H, Sawa H, Mitani S, Burglin TR, Shigesada K, Kohara Y (2005). The C. elegans RUNX transcription factor RNT-1/MAB-2 is required for asymmetrical cell division of the T blast cell. Dev Biol 287: 262-273. Kagoshima H, Shigesada K, Kohara Y (2007). RUNX regulates stem cell proliferation and differentiation: insights from studies of C. elegans. J Cell Biochem 100: 1119-1130. Kalderon D (2005). The mechanism of hedgehog signal transduction. Biochem Soc Trans 33: 1509-1512. Kamachi Y, Ogawa E, Asano M, Ishida S, Murakami Y, Satake M et al (1990). Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer. J Virol 64: 4808-4819. Kania MA, Bonner AS, Duffy JB, Gergen JP (1990). The Drosophila segmentation gene runt encodes a novel nuclear regulatory protein that is also expressed in the developing nervous system. Genes Dev 4: 1701-1713. Kasper M, Schnidar H, Neill GW, Hanneder M, Klingler S, Blaas L et al (2006). Selective modulation of Hedgehog/GLI target gene expression by epidermal growth factor signaling in human keratinocytes. Mol Cell Biol 26: 6283-6298. Kataoka H, Ochi M, Enomoto K, Yamaguchi A (2000). Cloning and embryonic expression patterns of the zebrafish Runt domain genes, runxa and runxb. Mech Dev 98: 139-143. Katinka M, Yaniv M, Vasseur M, Blangy D (1980). Expression of polyoma early functions in mouse embryonal carcinoma cells depends on sequence rearrangements in the beginning of the late region. Cell 20: 393-399. Katoh Y, Katoh M (2006). Hedgehog signaling pathway and gastrointestinal stem cell signaling network (review). Int J Mol Med 18: 1019-1023. Katoh Y, Katoh M (2008). Hedgehog signaling, epithelial-to-mesenchymal transition and miRNA (review). Int J Mol Med 22: 271-275. Katoh Y, Katoh M (2009). Hedgehog target genes: mechanisms of carcinogenesis induced by aberrant hedgehog signaling activation. Curr Mol Med 9: 873-886. Katsetos CD, Burger PC (1994). Medulloblastoma. Semin Diagn Pathol 11: 85-97. 105 Kawai S, Sugiura T (2001). Characterization of human bone morphogenetic protein (BMP)-4 and -7 gene promoters: activation of BMP promoters by Gli, a sonic hedgehog mediator. Bone 29: 54-61. Keeler RF (1978). Cyclopamine and related steroidal alkaloid teratogens: their occurrence, structural relationship, and biologic effects. Lipids 13: 708-715. Kenney AM, Rowitch DH (2000). Sonic hedgehog promotes G(1) cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol Cell Biol 20: 9055-9067. Kenney AM, Cole MD, Rowitch DH (2003). Nmyc upregulation by sonic hedgehog signaling promotes proliferation in developing cerebellar granule neuron precursors. Development 130: 15-28. Khatib ZA, Matsushime H, Valentine M, Shapiro DN, Sherr CJ, Look AT (1993). Coamplification of the CDK4 gene with MDM2 and GLI in human sarcomas. Cancer Res 53: 5535-5541. Kim TY, Lee HJ, Hwang KS, Lee M, Kim JW, Bang YJ et al (2004). Methylation of RUNX3 in various types of human cancers and premalignant stages of gastric carcinoma. Lab Invest 84: 479-484. Kim WJ, Kim EJ, Jeong P, Quan C, Kim J, Li QL et al (2005). RUNX3 inactivation by point mutations and aberrant DNA methylation in bladder tumors. Cancer Res 65: 9347-9354. Kinzler KW, Bigner SH, Bigner DD, Trent JM, Law ML, O'Brien SJ et al (1987). Identification of an amplified, highly expressed gene in a human glioma. Science 236: 70-73. Kinzler KW, Vogelstein B (1990). The GLI gene encodes a nuclear protein which binds specific sequences in the human genome. Mol Cell Biol 10: 634-642. Knudson AG, Jr. (1971). Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68: 820-823. Koh D, Wang H, Lee J, Chia KS, Lee HP, Goh CL (2003). Basal cell carcinoma, squamous cell carcinoma and melanoma of the skin: analysis of the Singapore Cancer Registry data 1968-97. Br J Dermatol 148: 1161-1166. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K et al (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89: 755-764. Kononen J, Bubendorf L, Kallioniemi A, Bärlund M, Schraml P, Leighton S et al (1998). Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med 4: 844-847. 106 Kudo Y, Tsunematsu T, Takata T (2010). Oncogenic role of RUNX3 in head and neck cancer. J Cell Biochem. In publication. Kump E, Ji J, Wernli M, Hausermann P, Erb P (2008). Gli2 upregulates cFlip and renders basal cell carcinoma cells resistant to death ligand-mediated apoptosis. Oncogene 27: 3856-3864. Lau QC, Raja E, Salto-Tellez M, Liu Q, Ito K, Inoue M et al (2006). RUNX3 is frequently inactivated by dual mechanisms of protein mislocalization and promoter hypermethylation in breast cancer. Cancer Res 66: 6512-6520. Lauth M, Bergstrom A, Shimokawa T, Toftgard R (2007). Inhibition of GLI-mediated transcription and tumor cell growth by small-molecule antagonists. Proc Natl Acad Sci U S A 104: 8455-8460. Lee B, Thirunavukkarasu K, Zhou L, Pastore L, Baldini A, Hecht J et al (1997). Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. Nat Genet 16: 307-310. Leung C, Lingbeek M, Shakhova O, Liu J, Tanger E, Saremaslani P et al (2004). Bmi1 is essential for cerebellar development and is overexpressed in human medulloblastomas. Nature 428: 337-341. Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, Chi XZ et al (2002). Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 109: 113124. Li X, Deng W, Lobo-Ruppert SM, Ruppert JM (2007). Gli1 acts through Snail and Ecadherin to promote nuclear signaling by beta-catenin. Oncogene 26: 4489-4498. Liu A, Wang B, Niswander LA (2005). Mouse intraflagellar transport proteins regulate both the activator and repressor functions of Gli transcription factors. Development 132: 3103-3111. Liu L, Andrews LG, Tollefsbol TO (2006). Loss of the human polycomb group protein BMI1 promotes cancer-specific cell death. Oncogene 25: 4370-4375. Liu Y, Cao X, Jiang J, Jia J (2007). Fused-Costal2 protein complex regulates Hedgehog-induced Smo phosphorylation and cell-surface accumulation. Genes Dev 21: 1949-1963. Logan CY, Nusse R (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20: 781-810. Madison BB, McKenna LB, Dolson D, Epstein DJ, Kaestner KH (2009). FoxF1 and FoxL1 link hedgehog signaling and the control of epithelial proliferation in the developing stomach and intestine. J Biol Chem 284: 5936-5944. 107 Mahlapuu M, Enerback S, Carlsson P (2001). Haploinsufficiency of the forkhead gene Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations. Development 128: 2397-2406. Marigo V, Scott MP, Johnson RL, Goodrich LV, Tabin CJ (1996). Conservation in hedgehog signaling: induction of a chicken patched homolog by Sonic hedgehog in the developing limb. Development 122: 1225-1233. Massague J, Blain SW, Lo RS (2000). TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103: 295-309. McGarvey TW, Maruta Y, Tomaszewski JE, Linnenbach AJ, Malkowicz SB (1998). PTCH gene mutations in invasive transitional cell carcinoma of the bladder. Oncogene 17: 1167-1172. Miething C, Grundler R, Mugler C, Brero S, Hoepfl J, Geigl J et al (2007). Retroviral insertional mutagenesis identifies RUNX genes involved in chronic myeloid leukemia disease persistence under imatinib treatment. Proc Natl Acad Sci U S A 104: 45944599. Miyazono K, Maeda S, Imamura T (2004). Coordinate regulation of cell growth and differentiation by TGF-beta superfamily and Runx proteins. Oncogene 23: 4232-4237. Mueller W, Nutt CL, Ehrich M, Riemenschneider MJ, von Deimling A, van den Boom D et al (2007). Downregulation of RUNX3 and TES by hypermethylation in glioblastoma. Oncogene 26: 583-593. Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S et al (1997). Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89: 773-779. Myohanen SK, Baylin SB, Herman JG (1998). Hypermethylation can selectively silence individual p16ink4A alleles in neoplasia. Cancer Res 58: 591-593. Nagata T, Gupta V, Sorce D, Kim WY, Sali A, Chait BT et al (1999). Immunoglobulin motif DNA recognition and heterodimerization of the PEBP2/CBF Runt domain. Nat Struct Biol 6: 615-619. Nam S, Jin YH, Li QL, Lee KY, Jeong GB, Ito Y et al (2002). Expression pattern, regulation, and biological role of runt domain transcription factor, run, in Caenorhabditis elegans. Mol Cell Biol 22: 547-554. Nevadunsky NS, Barbieri JS, Kwong J, Merritt MA, Welch WR, Berkowitz RS et al (2009). RUNX3 protein is overexpressed in human epithelial ovarian cancer. Gynecol Oncol 112: 325-330. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K et al (1989). Mutations in the p53 gene occur in diverse human tumour types. Nature 342: 705-708. 108 Nimmo R, Antebi A, Woollard A (2005). mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage. Development 132: 5043-5054. Northcott PA, Nakahara Y, Wu X, Feuk L, Ellison DW, Croul S et al (2009). Multiple recurrent genetic events converge on control of histone lysine methylation in medulloblastoma. Nat Genet 41: 465-472. Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito-Fujimoto M, Ito Y et al (1993). Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology 194: 314331. Oldak M, Grzela T, Lazarczyk M, Malejczyk J, Skopinski P (2001). Clinical aspects of disrupted Hedgehog signaling (Review). Int J Mol Med 8: 445-452. Olsen CL, Hsu PP, Glienke J, Rubanyi GM, Brooks AR (2004). Hedgehog-interacting protein is highly expressed in endothelial cells but down-regulated during angiogenesis and in several human tumors. BMC Cancer 4: 43-54. Oro AE, Higgins KM, Hu Z, Bonifas JM, Epstein EH, Jr., Scott MP (1997). Basal cell carcinomas in mice overexpressing sonic hedgehog. Science 276: 817-821. Osato M, Asou N, Abdalla E, Hoshino K, Yamasaki H, Okubo T et al (1999). Biallelic and heterozygous point mutations in the runt domain of the AML1/PEBP2alphaB gene associated with myeloblastic leukemias. Blood 93: 18171824. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR et al (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89: 765-771. Otto F, Lubbert M, Stock M (2003). Upstream and downstream targets of RUNX proteins. J Cell Biochem 89: 9-18. Pan J, Wang Q, Snell WJ (2005). Cilium-generated signaling and cilia-related disorders. Lab Invest 85: 452-463. Pereira BP, Zhou Y, Gupta A, Leong DT, Aung KZ, Ling L et al (2009). Runx2, p53, and pRB status as diagnostic parameters for deregulation of osteoblast growth and differentiation in a new pre-chemotherapeutic osteosarcoma cell line (OS1). J Cell Physiol 221: 778-788. Perry C, Eldor A, Soreq H (2002). Runx1/AML1 in leukemia: disrupted association with diverse protein partners. Leuk Res 26: 221-228. Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg L, Magnusson V et al (2002). A regulatory polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet 32: 666-669. 109 Raffel C, Jenkins RB, Frederick L, Hebrink D, Alderete B, Fults DW et al (1997). Sporadic medulloblastomas contain PTCH mutations. Cancer Res 57: 842-845. Raffel C (2004). Medulloblastoma: molecular genetics and animal models. Neoplasia 6: 310-322. Reddy S, Andl T, Bagasra A, Lu MM, Epstein DJ, Morrisey EE et al (2001). Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech Dev 107: 69-82. Regl G, Kasper M, Schnidar H, Eichberger T, Neill GW, Philpott MP et al (2004). Activation of the BCL2 promoter in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2. Cancer Res 64: 7724-7731. Reifenberger J, Wolter M, Knobbe CB, Kohler B, Schonicke A, Scharwachter C et al (2005). Somatic mutations in the PTCH, SMOH, SUFUH and TP53 genes in sporadic basal cell carcinomas. Br J Dermatol 152: 43-51. Rennert J, Coffman JA, Mushegian AR, Robertson AJ (2003). The evolution of Runx genes I. A comparative study of sequences from phylogenetically diverse model organisms. BMC Evol Biol 3: 4-15. Robertson AJ, Dickey CE, McCarthy JJ, Coffman JA (2002). The expression of SpRunt during sea urchin embryogenesis. Mech Dev 117: 327-330. Romer JT, Kimura H, Magdaleno S, Sasai K, Fuller C, Baines H et al (2004). Suppression of the Shh pathway using a small molecule inhibitor eliminates medulloblastoma in Ptc1(+/-)p53(-/-) mice. Cancer Cell 6: 229-240. Rorke LB, Trojanowski JQ, Lee VM, Zimmerman RA, Sutton LN, Biegel JA et al (1997). Primitive neuroectodermal tumors of the central nervous system. Brain Pathol 7: 765-784. Rubinfeld B, Robbins P, El-Gamil M, Albert I, Porfiri E, Polakis P (1997). Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 275: 1790-1792. Ruppert JM, Kinzler KW, Wong AJ, Bigner SH, Kao FT, Law ML et al (1988). The GLI-Kruppel family of human genes. Mol Cell Biol 8: 3104-3113. Ruppert JM, Vogelstein B, Arheden K, Kinzler KW (1990). GLI3 encodes a 190kilodalton protein with multiple regions of GLI similarity. Mol Cell Biol 10: 54085415. Salto-Tellez M, Peh BK, Ito K, Tan SH, Chong PY, Han HC et al (2006). RUNX3 protein is overexpressed in human basal cell carcinomas. Oncogene 25: 7646-7649. Sangiorgi E, Capecchi MR (2008). Bmi1 is expressed in vivo in intestinal stem cells. Nat Genet 40: 915-920. 110 Sato K, Tomizawa Y, Iijima H, Saito R, Ishizuka T, Nakajima T et al (2006). Epigenetic inactivation of the RUNX3 gene in lung cancer. Oncol Rep 15: 129-135. Scarano E (1971). The control of gene function in cell differentiation and in embryogenesis. Adv Cytopharmacol 1: 13-24. Schuller U, Zhao Q, Godinho SA, Heine VM, Medema RH, Pellman D et al (2007). Forkhead transcription factor FoxM1 regulates mitotic entry and prevents spindle defects in cerebellar granule neuron precursors. Mol Cell Biol 27: 8259-8270. Sheng T, Li C, Zhang X, Chi S, He N, Chen K et al (2004). Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer 3: 29-42. Shields PG, Harris CC (2000). Cancer risk and low-penetrance susceptibility genes in gene-environment interactions. J Clin Oncol 18: 2309-2315. Smyth I, Narang MA, Evans T, Heimann C, Nakamura Y, Chenevix-Trench G et al (1999). Isolation and characterization of human patched (PTCH2), a putative tumour suppressor gene inbasal cell carcinoma and medulloblastoma on chromosome 1p32. Hum Mol Genet 8: 291-297. Snijders AM, Schmidt BL, Fridlyand J, Dekker N, Pinkel D, Jordan RC et al (2005). Rare amplicons implicate frequent deregulation of cell fate specification pathways in oral squamous cell carcinoma. Oncogene 24: 4232-4242. Song WJ, Sullivan MG, Legare RD, Hutchings S, Tan X, Kufrin D et al (1999). Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukaemia. Nat Genet 23: 166-175. Speck NA, Gilliland DG (2002). Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer 2: 502-513. Stanton BZ, Peng LF, Maloof N, Nakai K, Wang X, Duffner JL et al (2009). A small molecule that binds Hedgehog and blocks its signaling in human cells. Nat Chem Biol 5: 154-156. Sterling JA, Oyajobi BO, Grubbs B, Padalecki SS, Munoz SA, Gupta A et al (2006). The hedgehog signaling molecule Gli2 induces parathyroid hormone-related peptide expression and osteolysis in metastatic human breast cancer cells. Cancer Res 66: 7548-7553. Stewart M, Terry A, Hu M, O'Hara M, Blyth K, Baxter E et al (1997). Proviral insertions induce the expression of bone-specific isoforms of PEBP2alphaA (CBFA1): evidence for a new myc collaborating oncogene. Proc Natl Acad Sci U S A 94: 86468651. Tahirov TH, Inoue-Bungo T, Morii H, Fujikawa A, Sasaki M, Kimura K et al (2001). Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell 104: 755-767. 111 Taipale J, Chen JK, Cooper MK, Wang B, Mann RK, Milenkovic L et al (2000). Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine. Nature 406: 1005-1009. Tanaka K, Chowdhury K, Chang KS, Israel M, Ito Y (1982). Isolation and characterization of polyoma virus mutants which grow in murine embryonal carcinoma and trophoblast cells. EMBO J 1: 1521-1527. Tanese K, Fukuma M, Yamada T, Mori T, Yoshikawa T, Watanabe W et al (2008). G-protein-coupled receptor GPR49 is up-regulated in basal cell carcinoma and promotes cell proliferation and tumor formation. Am J Pathol 173: 835-843. Tang X, Kim AL, Feith DJ, Pegg AE, Russo J, Zhang H et al (2004). Ornithine decarboxylase is a target for chemoprevention of basal and squamous cell carcinomas in Ptch1+/- mice. J Clin Invest 113: 867-875. Tanimura A, Dan S, Yoshida M (1998). Cloning of novel isoforms of the human Gli2 oncogene and their activities to enhance tax-dependent transcription of the human Tcell leukemia virus type genome. J Virol 72: 3958-3964. Taylor MD, Liu L, Raffel C, Hui CC, Mainprize TG, Zhang X et al (2002). Mutations in SUFU predispose to medulloblastoma. Nat Genet 31: 306-310. Teh MT, Wong ST, Neill GW, Ghali LR, Philpott MP, Quinn AG (2002). FOXM1 is a downstream target of Gli1 in basal cell carcinomas. Cancer Res 62: 4773-4780. Tokuhiro S, Yamada R, Chang X, Suzuki A, Kochi Y, Sawada T et al (2003). An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis. Nat Genet 35: 341-348. Tostar U, Malm CJ, Meis-Kindblom JM, Kindblom LG, Toftgard R, Unden AB (2006). Deregulation of the hedgehog signalling pathway: a possible role for the PTCH and SUFU genes in human rhabdomyoma and rhabdomyosarcoma development. J Pathol 208: 17-25. Tracey WD, Jr., Pepling ME, Horb ME, Thomsen GH, Gergen JP (1998). A Xenopus homologue of aml-1 reveals unexpected patterning mechanisms leading to the formation of embryonic blood. Development 125: 1371-1380. Tsunematsu T, Kudo Y, Iizuka S, Ogawa I, Fujita T, Kurihara H et al (2009). RUNX3 has an oncogenic role in head and neck cancer. PLoS One 4: e5892. van den Brink GR, Hardwick JC, Tytgat GN, Brink MA, Ten Kate FJ, Van Deventer SJ et al (2001). Sonic hedgehog regulates gastric gland morphogenesis in man and mouse. Gastroenterology 121: 317-328. van Wijnen AJ, Stein GS, Gergen JP, Groner Y, Hiebert SW, Ito Y et al (2004). Nomenclature for Runt-related (RUNX) proteins. Oncogene 23: 4209-4210. 112 Villavicencio EH, Yoon JW, Frank DJ, Fuchtbauer EM, Walterhouse DO, Iannaccone PM (2002). Cooperative E-box regulation of human GLI1 by TWIST and USF. Genesis. 32: 247-258. Vokes SA, Ji H, McCuine S, Tenzen T, Giles S, Zhong S et al (2007). Genomic characterization of Gli-activator targets in sonic hedgehog-mediated neural patterning. Development 134: 1977-1989. Vokes SA, Ji H, Wong WH, McMahon AP (2008). A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog-mediated patterning of the mammalian limb. Genes Dev 22: 2651-2663. Wada M, Yazumi S, Takaishi S, Hasegawa K, Sawada M, Tanaka H et al (2004). Frequent loss of RUNX3 gene expression in human bile duct and pancreatic cancer cell lines. Oncogene 23: 2401-2407. Wang Y, Zhou Z, Walsh CT, McMahon AP (2009). Selective translocation of intracellular Smoothened to the primary cilium in response to Hedgehog pathway modulation. Proc Natl Acad Sci U S A 106: 2623-2628. Weeraratna AT (2005). A Wnt-er wonderland--the complexity of Wnt signaling in melanoma. Cancer Metastasis Rev 24: 237-250. Wheatley DN, Wang AM, Strugnell GE (1996). Expression of primary cilia in mammalian cells. Cell Biol Int 20: 73-81. Williams JA, Guicherit OM, Zaharian BI, Xu Y, Chai L, Wichterle H et al (2003). Identification of a small molecule inhibitor of the hedgehog signaling pathway: effects on basal cell carcinoma-like lesions. Proc Natl Acad Sci U S A 100: 46164621. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, Zhang C et al (1998). Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391: 90-92. Xie J, Aszterbaum M, Zhang X, Bonifas JM, Zachary C, Epstein E et al (2001). A role of PDGFRalpha in basal cell carcinoma proliferation. Proc Natl Acad Sci U S A 98: 9255-9259. Yanagawa N, Tamura G, Oizumi H, Kanauchi N, Endoh M, Sadahiro M et al (2007). Promoter hypermethylation of RASSF1A and RUNX3 genes as an independent prognostic prediction marker in surgically resected non-small cell lung cancers. Lung Cancer 58: 131-138. Yanagida M, Osato M, Yamashita N, Liqun H, Jacob B, Wu F et al (2005). Increased dosage of Runx1/AML1 acts as a positive modulator of myeloid leukemogenesis in BXH2 mice. Oncogene 24: 4477-4485. Yauch RL, Gould SE, Scales SJ, Tang T, Tian H, Ahn CP et al (2008). A paracrine requirement for hedgehog signalling in cancer. Nature 455: 406-410. 113 Yoon JW, Kita Y, Frank DJ, Majewski RR, Konicek BA, Nobrega MA et al (2002). Gene expression profiling leads to identification of GLI1-binding elements in target genes and a role for multiple downstream pathways in GLI1-induced cell transformation. J Biol Chem 277: 5548-5555. Zaphiropoulos PG, Unden AB, Rahnama F, Hollingsworth RE, Toftgard R (1999). PTCH2, a novel human patched gene, undergoing alternative splicing and upregulated in basal cell carcinomas. Cancer Res 59: 787-792. 114 APPENDIX pGL3 VECTOR FOR CLONING OF PROMOTER 115 APPENDIX pRL-SV40 VECTOR 116 APPENDIX HUMAN RUNX3 cDNA (nucleotide 1-1784; Genbank accession no. Z35278) 117 APPENDIX HUMAN GLI1 cDNA (nucleotide 1-3618; Genbank accession no. NM_005269.2) CCCAGACTCCAGCCCTGGACCGCGCATCCCGAGCCCAGCGCCCAGACAGAGTGTCCCCACACCCTCCTCT GAGACGCCATGTTCAACTCGATGACCCCACCACCAATCAGTAGCTATGGCGAGCCCTGCTGTCTCCGGCC CCTCCCCAGTCAGGGGGCCCCCAGTGTGGGGACAGAAGGACTGTCTGGCCCGCCCTTCTGCCACCAAGCT AACCTCATGTCCGGCCCCCACAGTTATGGGCCAGCCAGAGAGACCAACAGCTGCACCGAGGGCCCACTCT TTTCTTCTCCCCGGAGTGCAGTCAAGTTGACCAAGAAGCGGGCACTGTCCATCTCACCTCTGTCGGATGC CAGCCTGGACCTGCAGACGGTTATCCGCACCTCACCCAGCTCCCTCGTAGCTTTCATCAACTCGCGATGC ACATCTCCAGGAGGCTCCTACGGTCATCTCTCCATTGGCACCATGAGCCCATCTCTGGGATTCCCAGCCC AGATGAATCACCAAAAAGGGCCCTCGCCTTCCTTTGGGGTCCAGCCTTGTGGTCCCCATGACTCTGCCCG GGGTGGGATGATCCCACATCCTCAGTCCCGGGGACCCTTCCCAACTTGCCAGCTGAAGTCTGAGCTGGAC ATGCTGGTTGGCAAGTGCCGGGAGGAACCCTTGGAAGGTGATATGTCCAGCCCCAACTCCACAGGCATAC AGGATCCCCTGTTGGGGATGCTGGATGGGCGGGAGGACCTCGAGAGAGAGGAGAAGCGTGAGCCTGAATC TGTGTATGAAACTGACTGCCGTTGGGATGGCTGCAGCCAGGAATTTGACTCCCAAGAGCAGCTGGTGCAC CACATCAACAGCGAGCACATCCACGGGGAGCGGAAGGAGTTCGTGTGCCACTGGGGGGGCTGCTCCAGGG AGCTGAGGCCCTTCAAAGCCCAGTACATGCTGGTGGTTCACATGCGCAGACACACTGGCGAGAAGCCACA CAAGTGCACGTTTGAAGGGTGCCGGAAGTCATACTCACGCCTCGAAAACCTGAAGACGCACCTGCGGTCA CACACGGGTGAGAAGCCATACATGTGTGAGCACGAGGGCTGCAGTAAAGCCTTCAGCAATGCCAGTGACC GAGCCAAGCACCAGAATCGGACCCATTCCAATGAGAAGCCGTATGTATGTAAGCTCCCTGGCTGCACCAA ACGCTATACAGATCCTAGCTCGCTGCGAAAACATGTCAAGACAGTGCATGGTCCTGACGCCCATGTGACC AAACGGCACCGTGGGGATGGCCCCCTGCCTCGGGCACCATCCATTTCTACAGTGGAGCCCAAGAGGGAGC GGGAAGGAGGTCCCATCAGGGAGGAAAGCAGACTGACTGTGCCAGAGGGTGCCATGAAGCCACAGCCAAG CCCTGGGGCCCAGTCATCCTGCAGCAGTGACCACTCCCCGGCAGGGAGTGCAGCCAATACAGACAGTGGT GTGGAAATGACTGGCAATGCAGGGGGCAGCACTGAAGACCTCTCCAGCTTGGACGAGGGACCTTGCATTG CTGGCACTGGTCTGTCCACTCTTCGCCGCCTTGAGAACCTCAGGCTGGACCAGCTACATCAACTCCGGCC AATAGGGACCCGGGGTCTCAAACTGCCCAGCTTGTCCCACACCGGTACCACTGTGTCCCGCCGCGTGGGC CCCCCAGTCTCTCTTGAACGCCGCAGCAGCAGCTCCAGCAGCATCAGCTCTGCCTATACTGTCAGCCGCC GCTCCTCCCTGGCCTCTCCTTTCCCCCCTGGCTCCCCACCAGAGAATGGAGCATCCTCCCTGCCTGGCCT TATGCCTGCCCAGCACTACCTGCTTCGGGCAAGATATGCTTCAGCCAGAGGGGGTGGTACTTCGCCCACT GCAGCATCCAGCCTGGATCGGATAGGTGGTCTTCCCATGCCTCCTTGGAGAAGCCGAGCCGAGTATCCAG GATACAACCCCAATGCAGGGGTCACCCGGAGGGCCAGTGACCCAGCCCAGGCTGCTGACCGTCCTGCTCC AGCTAGAGTCCAGAGGTTCAAGAGCCTGGGCTGTGTCCATACCCCACCCACTGTGGCAGGGGGAGGACAG AACTTTGATCCTTACCTCCCAACCTCTGTCTACTCACCACAGCCCCCCAGCATCACTGAGAATGCTGCCA TGGATGCTAGAGGGCTACAGGAAGAGCCAGAAGTTGGGACCTCCATGGTGGGCAGTGGTCTGAACCCCTA TATGGACTTCCCACCTACTGATACTCTGGGATATGGGGGACCTGAAGGGGCAGCAGCTGAGCCTTATGGA GCGAGGGGTCCAGGCTCTCTGCCTCTTGGGCCTGGTCCACCCACCAACTATGGCCCCAACCCCTGTCCCC AGCAGGCCTCATATCCTGACCCCACCCAAGAAACATGGGGTGAGTTCCCTTCCCACTCTGGGCTGTACCC AGGCCCCAAGGCTCTAGGTGGAACCTACAGCCAGTGTCCTCGACTTGAACATTATGGACAAGTGCAAGTC AAGCCAGAACAGGGGTGCCCAGTGGGGTCTGACTCCACAGGACTGGCACCCTGCCTCAATGCCCACCCCA GTGAGGGGCCCCCACATCCACAGCCTCTCTTTTCCCATTACCCCCAGCCCTCTCCTCCCCAATATCTCCA GTCAGGCCCCTATACCCAGCCACCCCCTGATTATCTTCCTTCAGAACCCAGGCCTTGCCTGGACTTTGAT TCCCCCACCCATTCCACAGGGCAGCTCAAGGCTCAGCTTGTGTGTAATTATGTTCAATCTCAACAGGAGC TACTGTGGGAGGGTGGGGGCAGGGAAGATGCCCCCGCCCAGGAACCTTCCTACCAGAGTCCCAAGTTTCT GGGGGGTTCCCAGGTTAGCCCAAGCCGTGCTAAAGCTCCAGTGAACACATATGGACCTGGCTTTGGACCC AACTTGCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGG CAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCC TCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCC TTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGG ACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTC TGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCC CTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGC ATTTCCTAAGGGGTTTCTATCCTTCCAGAAAAATTGGGGGAGCTGCAGTCCCATGCACAAGATGCCCCAG GGATGGGAGGTATGGGCTGGGGGCTATGTATAGTCTGTATACGTTTTGAGGAGAAATTTGATAATGACAC TGTTTCCTGATAATAAAGGAACTGCATCAGAAAAAAAAAAAAAAAAAA 118 APPENDIX SEQUENCE OF HUMAN GLI1 PROMOTER (1000 bp) (RUNX BINDING SITES UNDERLINED) 119 APPENDIX pLKO.1 LENTIVIRAL VECTOR Vector Element Utility Human U6 Promoter RNA generated with four uridine overhangs at each 3' end PGK Phosphoglycerate kinase promoter puroR Puromycin mammalian selectable marker SIN LTR 3' Self inactivating long terminal repeat f1 ori f1 origin of replication AMPr Ampicillin bacterial selectable marker 5'LTR 5' long terminal repeat RRE Rev response element 120 [...]... GACCACCCA sequence in the promoters of target genes (Kinzler and Vogelstein 1990, Ruppert et al 1990), and GLI2 recognizes a nearly identical GAACCACCCA motif (Tanimura et al 1998) GLI1 and GLI2 can act as transcriptional activators, whereas GLI3 has both activator and repressor functions (Huangfu and Anderson 2006) GLI1 and GLI2 have overlapping and distinct transcriptional regulator properties, and... activation step within the primary cilium (Wang et al 2009) Cyclopamine has poor water solubility and acid lability which hinders its utility as an easily administrable drug (Cooper et al 1998, Incardona et al 1998) Therefore, several derivatives such as KAADcyclopamine, with higher affinity and better bioavailability have been developed (Taipale et al 2000) 14 SANT1, SANT2, SANT3, SANT4 and HhAntag... KAAD-Cyclopamine Taipale et al 2000 SANT-1, SANT-2, SANT-3 and SANT-4 Chen et al 2002 HhAntag Romer et al 2004, Yauch et al 2008 CURR61414 Williams et al 2003 GDC-0449 Trial identifier # NCT00607724 GANT58 and GANT61 Lauth et al 2007 SMO GLI 15 The delineation of the SHH signaling pathway, the recognition that aberrant SHH signaling may lead to certain cancers, and the understanding of the pathway inhibition... crucial for maintaining the stem cell population, and regulating the development of hair follicles and sebaceous glands Although SHH has a minimal role in most adult tissues, it is known to be activated in basal cell carcinoma (BCC) (Botchkarev and Fessing 2005) and medulloblastoma (Goodrich et al 1997) In the absence of a signal, target gene transcription is turned off by the transmembrane protein Patched... nevoid basal-cell carcinoma syndrome (Gorlin 1987) Gorlin syndrome is an autosomal dominant disorder that predisposes to BCCs of the skin, ovarian fibromas, and medulloblastomas Using family-based linkage studies of kindreds with Gorlin syndrome, the locus carrying the causative mutant gene was mapped to human chromosome 9q22 (Gailani et al 1992) and then to the PTCH1 gene Loss of heterozygosity at this... SHH target genes 7 1.1.3 SHH signaling pathway during carcinogenesis SHH signaling cascade is aberrantly activated in a variety of human cancers (Table 2) GLI1 is amplified more than 50-fold in a malignant glioma (Kinzler et al 1987) In addition, the GLI1 gene is also amplified in rhabdomyosarcoma (Khatib et al 1993); indeed the combined haploinsufficiency for the two tumor suppressor genes PTCH1 and... movement and is not a preventive measure It is estimated that one in three born in the USA after 1994 will have at least one BCC in their lifetime (Einspahr et al 2002) An analysis of the Singapore Cancer Registry reveals that in Singapore, the incidence rate of BCC increases 3% annually (Koh et al 2003) The genes in the SHH pathway have a variety of loss of functions or activating mutations in BCCs (Table... et al 2002, Crosier et al 2002, Kataoka et al 2000), and one in Caenorhabditis elegans (Kagoshima et al 2005, Nam et al 2002, Nimmo et al 2005) RUNX homologs have also been described in basal metazoans, the most primitive organism described so far, with the findings of RUNX homologs in basal metazoans such as starlet sea anemone (Nematostella vectensis) (Ito 2008) and sponge (Oscarella carmela) (Kagoshima... functions as a negative regulator of the SHH pathway, is down-regulated in prostate cancers, compared with the corresponding normal tissues (Olsen et al 2004) On the other hand, the activation of the SHH pathway, through loss of SUFU, may be involved in tumor progression and metastases of prostate cancer (Sheng et al 2004) Table 2 Mechanisms of SHH signaling activation during carcinogenesis Type of Human Cancer... DNA-binding proteins that interact with the enhancers of retroviruses were characterized as Core-binding factor alpha (CBFα) PEBP2 was named after the murine cDNAs polyoma enhancer-binding proteins Other aliases, such as nuclear matrix protein 2 (NMP2), osteoblast-specific complex (OBSC) and osteoblast-specific factor 2 (OSF2) were also generated In November 1999, the Nomenclature Committee of the Human . can act as transcriptional activators, whereas GLI3 has both activator and repressor functions (Huangfu and Anderson 2006). GLI1 and GLI2 have overlapping and distinct transcriptional regulator. thank Dr Chan Shing Leng and Eileen, for their patience and guidance through my animal work. Many thanks also to the CSI administrative team (Selena, Deborah and Siew Hong) and the Department. of RUNX3 overexpression in Sonic Hedgehog (SHH) - related neoplasms. Through my screening, RUNX3 was up-regulated and active in basal cell carcinoma and desmoplastic medulloblastoma. Although