Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... future research tracks to improve para- phrase generation tools. 2 Statistical paraphrase generation using transformation rules The paraphrase generation problem can be seen as an exploration problem. ... In particular, it does not put constraint on the scoring function. We propose a variation of the UCT algorithm for paraphrase generation named MCPG for Monte- Carlo base...
Ngày tải lên: 17/03/2014, 02:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masar...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. The forward primer incorporated an NdeI site and the ... ethylene glycol. Gel filtration chromatography Gel filtration chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden), usin...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
... Merck KGaA (Darmstadt, Germany) and J T Baker Italia (Milan, Italy). Enzyme assays and identification of reaction products Enzyme assays The AMP–AMP phosphotransferase assay mixture con- tained 4.0 ... protein preparations. ADA was also isolated. When ADA was added to the assay mixture, AMP– AMP phosphotransferase activity was greatly enhanced. The purifications were performed as reported in...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx
... 182–191. 26 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res ... orders of magnitude. When viewed as a whole, it is apparent that these mutations have had the most beneficial effect on the decarboxylation of 2-ketopentanoic acid. Each variant...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx
... 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc tagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcct ccagagctctagaag-3¢, ... 5¢-tcgagaa ggtatattgctgttgacagtgagcgagag acggaagccacagacgtctcatg cctac tgcctcgg-3¢ and 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgt ctctcgctcactg...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... lab works image acquisition and analysis software was used to quan- tify band intensities. Antibodies were purchased from Tian- jin Saier Biotech and Sigma-Aldrich. Statistical analysis Data are ... complementarity, and are rarely fully comple- mentary; therefore, they function through translational repression rather than cleavage [5]. On the basis of this, miRNAs could control as many as...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 ... [Fe(N- His) 4 (SCys)] mononuclear iron center. Treponema palli- dum contains a variant of desulfoferrodoxin (class III SOR), composed of the C-terminal domain and a N-terminal domain that d...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... data that could allow for a struc- tured evaluation of the organizational changes. It is evi- dent that a well-planned evaluation of changes in the organizations, before they are actually made, ... emergency medical call centre organization reform in Finland. Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of...
Ngày tải lên: 25/10/2012, 10:02
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... metabolite Prashant N. Jethva, Jay R. Kardani and Ipsita Roy Department of Biotechnology, National Institute of Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, India Introduction The inability of ... effect of 50 lm dopamine on the aggregation process. Dopamine delayed the lag phase of aggregation marginally to 95.5 h from 86.8 h in the presence of MPTP alone. The...
Ngày tải lên: 14/02/2014, 19:20