Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... future research tracks to improve para-
phrase generation tools.
2 Statistical paraphrase generation using
transformation rules
The paraphrase generation problem can be seen as
an exploration problem. ... In particular,
it does not put constraint on the scoring function.
We propose a variation of the UCT algorithm for
paraphrase generation named MCPG for Monte-
Carlo base...
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,
and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢
and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA
GGGG-3¢ for the latter. The ... isolation and long-term
culture of organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masar...
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... for-
ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT
CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-
TATACTATCCTCGAGCCACTGCATATCACGGATAC
GACGC-3¢. The forward primer incorporated an NdeI site
and the ... ethylene
glycol.
Gel filtration chromatography
Gel filtration chromatography was performed on a
SMART chromatographic workstation (Pharmacia, GE
Healthcare Biosciences AB, Uppsala, Sweden), usin...
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
... Merck KGaA (Darmstadt,
Germany) and J T Baker Italia (Milan, Italy).
Enzyme assays and identification of reaction
products
Enzyme assays
The AMP–AMP phosphotransferase assay mixture con-
tained 4.0 ... protein preparations. ADA was also isolated.
When ADA was added to the assay mixture, AMP–
AMP phosphotransferase activity was greatly
enhanced.
The purifications were performed as reported in...
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx
... 182–191.
26 Altschul SF, Madden TL, Schaffer AA, Zhang J,
Zhang Z, Miller W & Lipman DJ (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res ... orders of
magnitude. When viewed as a whole, it is apparent
that these mutations have had the most beneficial
effect on the decarboxylation of 2-ketopentanoic acid.
Each variant...
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx
... 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc
tagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atgg
aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca
ggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcct
ccagagctctagaag-3¢, ... 5¢-tcgagaa
ggtatattgctgttgacagtgagcgagag acggaagccacagacgtctcatg cctac
tgcctcgg-3¢ and 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgt
ctctcgctcactg...
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... lab works
image acquisition and analysis software was used to quan-
tify band intensities. Antibodies were purchased from Tian-
jin Saier Biotech and Sigma-Aldrich.
Statistical analysis
Data are ... complementarity, and are rarely fully comple-
mentary; therefore, they function through translational
repression rather than cleavage [5]. On the basis of
this, miRNAs could control as many as...
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... 5¢-ATGGTAGGTCTCAAATGATAGGAA
ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev,
5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA
TTTTTTGC-3¢.
The gene mm0632 was cloned via BsaI restriction sites in
plasmid pASK-IBA3 ... [Fe(N-
His)
4
(SCys)] mononuclear iron center. Treponema palli-
dum contains a variant of desulfoferrodoxin (class III
SOR), composed of the C-terminal domain and a
N-terminal domain that d...
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... data that could allow for a struc-
tured evaluation of the organizational changes. It is evi-
dent that a well-planned evaluation of changes in the
organizations, before they are actually made, ... emergency
medical call centre organization reform in Finland.
Material and methods
A retrospective observational study was conducted in
the EMCC in East and Central Uusimaa, an area of...
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... metabolite
Prashant N. Jethva, Jay R. Kardani and Ipsita Roy
Department of Biotechnology, National Institute of Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, India
Introduction
The inability of ... effect of 50 lm dopamine on
the aggregation process. Dopamine delayed the lag
phase of aggregation marginally to 95.5 h from 86.8 h
in the presence of MPTP alone. The...