A molecule detector adsorbate induced conductance gap change of ultra thin silicon nanowire

A molecule detector adsorbate induced conductance gap change of ultra thin silicon nanowire

A molecule detector adsorbate induced conductance gap change of ultra thin silicon nanowire

... A molecule detector: Adsorbate induced conductance gap change of ultra- thin silicon nanowire Y.H. Zhang a , X.Q. Zhang b ,H.Li b , C .A. Taft a, * , G. Paiva c a Centro Brasileiro de pesquisas ... only a moderate adsorbate sensitivity. Fortunately, the conductance gap clearly changes in response to different adsorbates. Technological advances in fabricat...

Ngày tải lên: 16/03/2014, 15:32

5 301 0
Controlled growth of oriented amorphous silicon nanowires via a solid–liquid–solid (SLS) mechanism

Controlled growth of oriented amorphous silicon nanowires via a solid–liquid–solid (SLS) mechanism

... substrate. The silicon subs- trate was cleaned ultrasonically in pure petroleum ether and in ethanol in turns for 5 min, and leached in distilled water, then dried. A thin layer of 40 nm nickel was ... proved that the nanowires are composed of Si, but there exists a small amount of oxygen in the SiNWs, which was attributed to the surface oxidation sheathing the nanowires. The TE...

Ngày tải lên: 16/03/2014, 15:14

5 386 0
A study on how oral practice can change TNH 10th graders' attitudes towards grammar learning

A study on how oral practice can change TNH 10th graders' attitudes towards grammar learning

... i A study on how oral practice can change TNH 10 th graders' attitudes towards grammar learning TABLE OF CONTENTS A study on how oral practice can change TNH 10th graders' attitudes ... certain application of oral grammar practice in teaching and learning at TNH High School. As the result, students’ attitudes can be changed from negative to positive because oral gra...

Ngày tải lên: 10/04/2013, 14:46

75 476 0
Tài liệu More Than a Message: Framing Public Health Advocacy to Change Corporate Practices docx

Tài liệu More Than a Message: Framing Public Health Advocacy to Change Corporate Practices docx

... Education & Behavior (June 2005)Dorfman et al. / More Than a Message More Than a Message: Framing Public Health Advocacy to Change Corporate Practices Lori Dorfman, DrPH Lawrence Wallack, DrPH Katie ... discipline, and hard work are seen as dominant factors, reinforcing individualism. A shift to social justice demands a rebalancing of these values with others that Americans al...

Ngày tải lên: 14/02/2014, 13:20

17 352 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
Adapting for a Green Economy: Companies, Communities and Climate Change docx

Adapting for a Green Economy: Companies, Communities and Climate Change docx

... WHAT IS MALADAPTATION? Caring for Climate defines maladaptation as “an action or process that increases vulnera- bility to climate change- related hazards. Maladaptive actions and processes often ... economic damage, erodes natural and human-constructed storm barriers, and results in loss of life. It also leads to loss of agricultural land. Increased salinization of coastal are...

Ngày tải lên: 19/03/2014, 16:20

72 441 0
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx

Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx

... (85 amino acids) consists of three domains: a signal peptide (24 amino acids), prodomain (40 amino acids) andamaturepeptide(21aminoacids).Thegenehastwo introns and three exons. A TATA box and ... primer 219R, and a Ôpoly A headÕ was created following incubation with dATP and terminal deoxynucleotide transferase (Stratagene). The cDNA with the polyA head was amplified with the primer...

Ngày tải lên: 24/03/2014, 03:21

6 366 0
w