Báo cáo khoa học: A structural overview of the PDI family of proteins docx

... reveals interac- tion between ERp57 and the tip of the calreticulin P-domain. Proc Natl Acad Sci USA 99, 1954–1959. 53 Satoh M, Shimada A, Keino H, Kashiwai A, Nagai N, Saga S & Hosokawa M ... domain arrangement, but share the common structural feature of having at least one domain with a thioredoxin-like structural fold, babababba. Most PDI family members contain bo...

Ngày tải lên: 15/03/2014, 23:20

... strain carried the deletion of the chromosomal atp2 operon and several copies of a plasmid carrying the mutated atp2 operon. As a control, a parallel at p2-deleted strain w as created, in which the ... [34]) as a standard. The amounts of chromatophores and standard protein in the different lanes of a single gel were kept in the linear range of the luminol a...

Ngày tải lên: 21/02/2014, 03:20

... probability over a range of possible parameters, and per- mits the use of priors favoring the sparse distributions that are typical of natural lan- guage. Our model has the structure of a standard ... for the hidden vari- ables in the model are then chosen based on the learned parameterization. Here, we propose a dif- ferent approach based on Bayesian statistical pri...

Ngày tải lên: 20/02/2014, 12:20

... of matrix sparse- ness can be minimized by reducing the dimension- ality of the matrix. An appropriate algebraic method that has the capability to reduce the dimen- sionality of a rectangular ... our attention to the various species of ani- mals that are among the top 30 associations to poach. Some of them seem more often affected by cooking (pheasant, chicken, salm...

Ngày tải lên: 20/02/2014, 16:20

... used as a positive control to display omcA (lane 1) and omcB (lane 6). DNA standards are indicated at the left and right of the agarose gels. (B) Visualization and separation of high molecular mass ... shows the absence of mature OmcA (83 kDa) and OmcB (78 kDa) in an omcA – and an omcB – background, respectively, a complete lack of both proteins in the omcA – omcB – doub...

Ngày tải lên: 07/03/2014, 09:20

... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...

Ngày tải lên: 07/03/2014, 12:20

... template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). The ... (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGATCTAGA...

Ngày tải lên: 07/03/2014, 16:20

... as well as model the adjacent output labels. The additional features we 167 introduced are: • the distance to the next same word and the next same POS tag. • a binary feature to indicate if there ... features: • All the bigrams and trigrams of words and POS tags in the candidate sentence. • Bigrams and trigrams of words and POS tags in the original sentence in combinatio...

Ngày tải lên: 07/03/2014, 18:20

... clearance and further metabo- lism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals. Up to now there are few data available on the fate of an allergen after ... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease. The fate of Der p 2 was followed both at the whole-...

Ngày tải lên: 07/03/2014, 21:20

... comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate alge- braic method that has the capability to reduce the ... words as one of their core tasks, and as a consequence accurate lexicons providing such information are readily available for many lan- guages. Nevertheless, deriving word classe...

Ngày tải lên: 08/03/2014, 04:22