Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and ... site-specific mutagenesis – distal effects on dimer stability Moumita Samanta 1 , Mousumi Banerjee 1 , Mathur R. N. Murthy 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Bioph...
Ngày tải lên : 14/03/2014, 23:20
  • 12
  • 393
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... is the His residue that in NirS is the proximal axial ligand to the d 1 heme. Replacement of an equivalent His, His41, in NirF by Ala abolished binding of the heme to the protein. Known distal ... aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also conserved 98 kDa M Wt Insoluble...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... eukaryotic organelles that are involved in lipid and antioxidant metabolism. They are versatile and dynamic organelles engaged in the b-oxidation of long and very long chain fatty...
Ngày tải lên : 07/03/2014, 05:20
  • 11
  • 568
  • 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

... cell lines and tissues using Trizol (Invitrogen, Carlsbad, CA, USA) reagent following the manufacturer’s instuctions. Total RNA was digested with RNAase-free DNase I (TaKaRa Carlsbad, CA, USA) at ... results indicated that NANOGP8 was expressed in human osteosarcoma cell line OS732, human hepatoma cell line HepG2 and human breast adenocarcinoma cell line MCF-7 (Table 1). At the same time,...
Ngày tải lên : 07/03/2014, 12:20
  • 8
  • 495
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAAC...
Ngày tải lên : 07/03/2014, 15:20
  • 8
  • 485
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols described in ... target genes. The data were deposited in GEO database GSE2043 (a complete list of these genes appears in Table S1 and a partial list is shown in Table 1). Because only a single...
Ngày tải lên : 07/03/2014, 17:20
  • 16
  • 476
  • 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... replacing cysteine with serine in domain 2, and results showed that the second LIM domain plays a central role in bundling of F-actin. Taken together, these data identify hhLIM as an actin-binding protein ... transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12]. Cons...
Ngày tải lên : 16/03/2014, 06:20
  • 11
  • 347
  • 0
Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx

Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx

... processing. In Proc. 35 th Annual Meeting of the Association for Computational Linguistics, pages 88-95, Mad- rid, Spain. Morgan Kaufmann. Claire Gardent. 1997. Discourse tree adjoining grammars. ... situation associated with B is a cause for that associated with A and that the situ- ation associated with B is one of a set of such causes. Finally, Example 2d adds to...
Ngày tải lên : 20/02/2014, 18:20
  • 8
  • 415
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... imply that bacitracin is not a selective inhibi- tor of PDI. Instead, bacitracin can also interact with folding polypeptide chains and other molecular chaper- ones and folding catalysts. Bacitracin ... well as the isolated catalytic a domain of PDI. Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding site, but lack an inde- pendent substrate-...
Ngày tải lên : 16/02/2014, 14:20
  • 9
  • 620
  • 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. Transcription factor SAF-3 is expressed during in ammation FEBS ... compilation ª 2009 FEBS SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during in ammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Pa...
Ngày tải lên : 07/03/2014, 02:20
  • 11
  • 439
  • 0

Xem thêm

Từ khóa: