Báo cáo khoa học: A novel isoform of pantothenate synthetase in the Archaea potx

... in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans. Also, they are absent from the Bacteria and Eukaryota. All of the Archaea that have ... reconstruction in the Archaea. The linear pathway leading from a- ketoisovalerate to CoA comprises eight steps in the Bacteria and Eukaryota. It proceeds via pa...

Ngày tải lên: 07/03/2014, 05:20

... expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas. The characteri- zation and functions of prosemin are described. Results cDNA cloning and structure of the ... (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnI sites to produ...

Ngày tải lên: 16/03/2014, 23:20

... model was applied to the test set. 4.3 n-gram Part -of- Speech Model Separating the data into training, validation and test sets was carried out by generating a random dialogue ID. The IDs are in the ... test data. The validation data was necessary for building the CMU-Cambridge language model, but was concatenated with the training set for the other models. The model wa...

Ngày tải lên: 22/02/2014, 02:20

... Thomas-Oates, J.E. & Brade, H. (1994) Preparation and structural analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota ... which links the O-7 of a Hep residue, and a 2-amino-2-deoxy galactose (GalN), which is the branching point of the oligosaccharide. The amino function of the GalN resid...

Ngày tải lên: 19/02/2014, 13:20

... within the hexamer. Specifically, these cru- cial ‘flex points’ appear to be at the back of the gluta- mate binding domain near residue 35 and within the GTP binding site. Again, the loop that contains ... demonstrate that zinc does indeed cause changes in local flexibility, and it is interesting that all of the zinc-induced changes are regions located either at the base of...

Ngày tải lên: 05/03/2014, 23:20

... against a shifting target: a structural basis for resistance to inhibitors in a variant of in uenza virus neuraminidase. Structure 6, 735–746. 13 Ely B & Pittard J (1979) Aromatic amino acid biosynthesis: ... were purchased and used in further evaluation of their antimycobacterial activities. Antimycobacterial activities of the selected ligands in vitro We first evalua...

Ngày tải lên: 07/03/2014, 03:20

... GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sense CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ... 3T3 fibroblasts. These data reveal a novel mechanism of cross-talk between the classical TGFb ⁄ Smad pathway and Rho GTPases, regulating the rapid and th...

Ngày tải lên: 16/03/2014, 06:20

... amount of training data available 4 , the feature space must be kept small to avoid overfit- ting. Starting with the cosine similarity score as the baseline feature, we progressively enrich the model with ... (partially) shared by some of the other seven re- searchers. Comparison with Other Hypotheses Another way of evaluating the output of B and J is to compare them with...

Ngày tải lên: 08/03/2014, 02:21

... be cancelled. We are not aware of any forma- lism or computational approach that offers a unified explanation for the cancellability of pragmatic infe- rences in general, and of no approach ... contains more information and that information can be more easily updated in the fu- ture. That means that if an interpretation m0 makes an utterance true by assigning to a rela...

Ngày tải lên: 08/03/2014, 07:20

... Point as an admiral, and not, as is actually the case, subsequent to graduation from the Naval academy. Notice that the formula in (33) , which represents the translation of (31) in my analysis, ... graduated at the same time, 2. since the P operator forces tem- poral evaluation of all predicates in its scope at the same index, in the case of (31) it require...

Ngày tải lên: 08/03/2014, 18:20