Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... 149–161. 37 Kato H, Tanaka S, Oikawa T, Koike T, Takahashi A & Itoyama Y (2000) Expression of microglial response factor-1 in microglia and macrophages following cere- bral ischemia in the rat. Brain ... pro- cesses of various human diseases, including ischemia, carcinogenesis, radiation injury and inflammation ⁄ immune injury [1,2]. Oxidative stresses are known to cause the brai...

Ngày tải lên: 18/02/2014, 17:20

... the BAC clone using Pfu-turbo DNA poly- merase (Stratagene, La Jolla, USA). The 5¢ primer contained a HindIII restriction site (underlined) and had the sequence 5¢-gacatca aagcttATGGATAAAGCCATT CAGCATCCT-3¢, ... Chal- font, Bucks., UK) with NotI-d(T) 18 as a primer. For Y 7 , these were: forward primer 5¢-GAGGAAATCCCATCTAT CAACC and reverse primer 5¢-AGACCACGACTACCAT CACC. For ampli...

Ngày tải lên: 19/02/2014, 07:20

... c 1 and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 significantly decreased in this mutant strain. However, the amounts of ... Electro- phoretic analysis of DNA on agarose gels, restriction endonuclease analysis, ligation of DNA fragments, Table 1. Yeast strains used in this study. Strain Genotyp...

Ngày tải lên: 19/02/2014, 12:20

... that after normalization, the polarization changes had similar trends as the titration experiments in the absence of the GST-PDZ protein (Fig. 6B). Therefore, it appears that binding of the PDZ domain ... SH2 domain is improved at each step of the purification procedure (Fig. 1B). A synthetic DNA fragment encoding the PDZ domain of PDZ-RGS3 was prepared in...

Ngày tải lên: 19/02/2014, 12:20

... each. A single amino acid (aa) substitution was confirmed to affect the thermal stabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal stability is acquired ... blomhoffii DNases I Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any DNA contamination was removed b...

Ngày tải lên: 20/02/2014, 23:20

... 3927 The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4 -a- helical bundle domain Mo ´ nica Balsera 1 , Juan B. Arellano 1 , Florencio Pazos 2, *, Damien Devos 2, †, Alfonso ... same characteristics of the interior of the protein matrix. The script a is the peak–peak distance between the maximum at %287 nm...

Ngày tải lên: 21/02/2014, 00:20

... within tissues and as a barrier to cell migration. Additionally, the destruction of the ECM can regulate disease progression and severity in a variety of pathological situations [1–3]. The matrix ... constitutive expression of MMP-1 in melanoma cells. Keywords: antisense; MAPK; matrix metalloproteinase; melanoma and metastasis; signal transduction. The extracellular matrix (...

Ngày tải lên: 21/02/2014, 00:20

... TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. ... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGT...

Ngày tải lên: 14/02/2014, 14:20

... increase in the amount of DRM-associated tau isolated from wild-type neurons (Fig. 5A) . In contrast, pervanadate did not appear to induce any change in the amount of tau in the DRM fraction isolated ... Pervandate and catalase were prepared as described previously [25]. Briefly, vanadate stock solution was prepared as a 200 m M solution of sodium orthovanadate (pH 10). Pervanada...

Ngày tải lên: 14/02/2014, 14:20

... concentrations are summarized in Fig. 4A. The data clearly show that a sharp peak (quick up–down conformational change of SERCA) was rarely observed and that the lifetime of the elevated conformation ... bio- chemical assay showed that the turnover rate of ATP hydrolysis of SERCA linearly increased with ATP concentrations of  1 lm [26]. The lifetime of the elevated...

Ngày tải lên: 14/02/2014, 14:20