Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efﬁciently protects against brain ischemic insult pptx

... 149–161.37 Kato H, Tanaka S, Oikawa T, Koike T, Takahashi A & Itoyama Y (2000) Expression of microglial responsefactor-1 in microglia and macrophages following cere-bral ischemia in the rat. Brain ... pro-cesses of various human diseases, including ischemia,carcinogenesis, radiation injury and inﬂammation ⁄immune injury [1,2].Oxidative stresses are known to cause the brainlesions that characterize ... efﬁcientlyprotects against such damage. It is well known thatDNA damage triggers a cell-death mechanism andinduces apoptosis. These results indicate that the trans-duced PEP-1–HSP27 fusion protein efﬁciently...

Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

... the BAC clone using Pfu-turbo DNA poly-merase (Stratagene, La Jolla, USA). The 5¢ primercontained a HindIII restriction site (underlined) and had the sequence 5¢-gacatcaaagcttATGGATAAAGCCATTCAGCATCCT-3¢, ... Chal-font, Bucks., UK) with NotI-d(T)18as a primer. For Y7,these were: forward primer 5¢-GAGGAAATCCCATCTATCAACC and reverse primer 5¢-AGACCACGACTACCATCACC. For ampliﬁcation of Y2, the ... GCACAATGTATTCACCAGCAGA. Actin, used as a positive control to monitor the efﬁcacy of reverse transcription, was ampliﬁed as part of the analysis of Y6expression using forward primer5¢-TGGGTATGGAGTCCTGTGGT...

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... c1and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 signiﬁcantly decreased in this mutantstrain. However, the amounts of ... Electro-phoretic analysis of DNA on agarose gels, restrictionendonuclease analysis, ligation of DNA fragments,Table 1. Yeast strains used in this study.Strain Genotype ReferenceW303–1 A (WT) MATa, ade2–1, ... Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680–685.26. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram...

Tài liệu Báo cáo khoa học: Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-afﬁnity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein ppt

... that after normalization, the polarizationchanges had similar trends as the titration experiments in the absence of the GST-PDZ protein (Fig. 6B). Therefore,it appears that binding of the PDZ domain ... SH2 domain is improved at each step of the puriﬁcation procedure (Fig. 1B). A synthetic DNAfragment encoding the PDZ domain of PDZ-RGS3 wasprepared in the same way as for the SH2 domain basedon ... interactions between the peptides and the Grb4 SH2 domain. The afﬁnity of the binding interactions was evaluated by measuring the changes of ﬂuorescence polarization of the peptides at each step of...

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... each. A single amino acid(aa) substitution was conﬁrmed to affect the thermalstabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal stability is acquired ... blomhofﬁiDNases ITotal RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method[24] and any DNA contamination was removed by treat-ment with RNase-free ... wild-typecounterparts, whereas human (Met166Leu) was not. The same was true for these mutants of the rat and mouseDNase I (Fig. 3). These ﬁndings demonstrate that the nature of the amino acid at position...

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... 3927 The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4 -a- helical bundle domain Mo´nica Balsera1, Juan B. Arellano1, Florencio Pazos2,*, Damien Devos2,†, Alfonso ... samecharacteristics of the interior of the protein matrix. The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak ... rnand ruare the experimentally determinednumerical values of the ratio a/ b, and r a is the theoreticalnumerical value of ratio a/ b for a mixture of aromaticamino acids (Tyr and Trp), containing...

Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx

... within tissues and as a barrier to cell migration.Additionally, the destruction of the ECM can regulatedisease progression and severity in a variety of pathologicalsituations [1–3]. The matrix ... constitutiveexpression of MMP-1 in melanoma cells.Keywords: antisense; MAPK; matrix metalloproteinase;melanoma and metastasis; signal transduction. The extracellular matrix (ECM) acts as a structural supportnetwork ... amplify a region uniqueto the transcript. The forward primer for Fra-1 was5¢-TCTGGGCTGCAGCGAGAGATTGAGGAG-3¢ and the reverse primer was 5¢-GGAGGAGACATTGGCTAGGGTGGCATC-3¢, giving a product of...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. ... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... Biochemistry 44,11715–11721.27 Mata NL, Radu RA, Clemmons RC & Travis GH(2002) Isomerization and oxidation of vitamin a incone-dominant retinas: a novel pathway for visual-pig-ment regeneration...

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... increase in the amount of DRM-associated tau isolated from wild-type neurons(Fig. 5A) . In contrast, pervanadate did not appear toinduce any change in the amount of tau in the DRMfraction isolated ... Pervandate and catalase wereprepared as described previously [25]. Brieﬂy, vanadatestock solution was prepared as a 200 mM solution of sodium orthovanadate (pH 10). Pervanadate was preparedas ... neurons (Fig. 5B).Quantitation of the amount of DRM-associated tau as a proportion of the total tau in the corresponding celllysates revealed a signiﬁcant increase in the amount of tau present in...

Tài liệu Báo cáo khoa học: Motion of the Ca2+ -pump captured ppt

... concentrations are summarized in Fig. 4A. The data clearly show that a sharp peak (quick up–downconformational change of SERCA) was rarely observedand that the lifetime of the elevated conformation ... bio-chemical assay showed that the turnover rate of ATPhydrolysis of SERCA linearly increased with ATPconcentrations of  1 lm [26]. The lifetime of the elevated conformation (i.e. peakwidth) in the ... conformation wasapparently increased. The increased lifetime of the ele-vated conformation at low Ca2+concentration couldreasonably be a reﬂection of lowered ATPase activity at low Ca2+concentrations...

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP