0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx

Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx

Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx

... FEBS Glutamine incorporation in Caco-2 proteins K. Lenaerts et al. Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation ... intestinal injury [35], few data are available onthe uptake mechanisms of glutamine by the basolateral membrane of Caco-2 cells. As mentioned above, sys-tem L plays a role in glutamine uptake across ... below.Measurement of L -glutamine uptake by Caco-2 cells Glutamine uptake in Caco-2 cells was initiated by addingexperimental medium containing 0.1, 2.0 or 8.0 mml-gluta-mine, trace-labelled with...
  • 15
  • 506
  • 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... plot of thebinding-inhibition curve was curvilinear, indicative of high-affinity andlow-affinity sites for PCSK9 binding on HepG2 cells. Nonlinear regressionanalysis of the binding data also indicated ... triplicate wells were incubated with 0.5 mL of incubation medium containing 10 lgÆmL)1 of antibodyagainst LDLR for 90 min at 4 °C. The cells were thenwashed, and the amount of bound antibody against ... SR, TaylorCA Jr & Attie AD (1983) A radioiodinated, intracellu-larly trapped ligand for determining the sites of plasmaprotein degradation in vivo. Biochem J 212, 791–800.46 Martinsson...
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... InsP6gradually into InsP5, InsP4,and the final product – Ins(2,4,6)P3and Ins(1,3,5)P3–via two alternative pathways [14].Bacterial BPPs containing two tandemly repeateddomains (dual domains) ... wasdetermined using the Bradford assay with BSA as thestandard [28].Phytase activity assayPhytase activity was determined by measuring the amount of phosphate released from InsP6using a modified ... can increasethe amount of available phosphate by interacting together. Additionally,fusing PhyH-DI to a single-domain phytase appears to be an efficient wayto improve the activity of the latter.IntroductionPhytate...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3and K. Ravi Acharya11 Department ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... hypoxanthinebases, respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the purine base and Asp137 was observed in HPRT in complex with ImmGP, indicating ... ImmGP, indicating a role in transitionstate stabilization during catalysis [17]. A series of mutations were made of the invariantAsp in HPRT from Trypanosoma cruzi. The D137Gmutation in this enzyme,...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... quantitative interaction data in terms of the affinity constants (K a ) of a series of lectins for a panel of pyridylaminated glycansobtained by automated frontal affinity chromatogra-phy with ... compared with those of RCA120. Overlapping proteins appearing in the dark gray area of the Venn diagram are thought to be relatively abundant in serum,and are primary candidates for further validation. ... a common glycome, arguing for a commonorigin. Nat Chem Biol 5, 244–250.16 Kuno A, Itakura Y, Toyoda M, Takahashi Y, YamadaM, Umezawa A & Hirabayashi J (2008) Development of a data-mining...
  • 11
  • 854
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... fluorescence staining technique that enablesvisualization of extracellular and intracellular bacteria in the same cell [25]. The results concurred with thedata from the gentamicin-based invasion assay. ... reveal a new aspect of thecomplex interplay in host–pathogen interactions anddemonstrate a physiological role of the deubiquitinat-ing enzyme OTUB1 in Yersinia invasion. OTUB1 as a potential ... subsequently inhibitsGaq-mediated signalling pathways including RhoAactivation and cytoskeletal rearrangements in the hostcell [15]. In addition, a crystallography-based studyrevealed that YpkA mimics...
  • 16
  • 654
  • 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACGR1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAAR1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D GCACTAGTATGAAAAGAATAAGATCGCTTTATH1_pUG36_R...
  • 15
  • 475
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ