Tài liệu Báo cáo khoa học: Catalytic mechanism of SGAP, a double-zinc aminopeptidase from Streptomyces griseus pdf

... structural data, a general catalytic mechanism was proposed for aminopeptidases that involves an acidic residue acting as a general acid ⁄ gen- eral base and a di-nuclear metal center participating ... in catalysis. Abbreviations AAP, Aeromonas proteolytica aminopeptidase; blLAP, bovine lens leucine aminopeptidase; Leu-pNA, leucine-para-nitroanilide; SGAP, Streptomyces griseu...

Ngày tải lên: 19/02/2014, 02:20

... structure and catalysis. Biochemistry 48, 3417–3424. 31 Nakamura T, Matsumura H, Inoue T, Kai Y, Uegaki K, Hagihara Y, Ataka M & Ishikawa K (2005) Crystallization and preliminary X-ray diffraction analysis ... Nakamura T, Yamamoto T, Abe M, Matsumura H, Hagihara Y, Goto T, Yamaguchi T & Inoue T. (2008) Oxidation of archaeal peroxiredoxin involves a hyperva- lent sulfur intermediat...

Ngày tải lên: 14/02/2014, 22:20

... N.N. & Braunstein, A. E. (1947) Labilization of a- hydrogen of amino acids under the action of aminoferase. Biokhimia 12, 556–568 (in Russian). 2. Esaki, N., Nakayuma, T., Sawada, S., Tanaka, ... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The l...

Ngày tải lên: 19/02/2014, 16:20

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , Harry Boer 2 , Anu Koivula 2 , Kristiina Kruus 2 , Juha ... observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank d...

Ngày tải lên: 14/02/2014, 18:20

... atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z ‡ 4 are treated as outliers and discarded. After ... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in...

Ngày tải lên: 14/02/2014, 19:20

... Bxe _A2 876 (accession number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS dat...

Ngày tải lên: 18/02/2014, 06:20

... 341, 335–351. 3 Lacadena J, A ´ lvarez-Garcı ´ a E, Carreras-Sangra N, Herrero-Gala ´ n E, Alegre-Cebollada J, Garcı ´ a- Ortega L, On ˜ aderra M, Gavilanes JG & Martı ´ nez del Pozo A (2007) Fungal ribotoxins: ... Martı ´ nez-Ruiz A, Garcı ´ a- Ortega L, Kao R, Lacadena J, On ˜ aderra M, Manchen ˜ o JM, Davies J, Martı ´ nez del Pozo A & Gavilanes JG (2001) RNase U2 and al...

Ngày tải lên: 18/02/2014, 08:20

... benzo [a] pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases Oksana M. Subach 1 , Diana V. Maltseva 1 , Anant Shastry 2 , Alexander Kolbanovskiy 2 , Saulius Klimas ˇ auskas 3 , ... Wyszynski MW, Gabbara S, Kubareva EA, Romanova EA, Oretskaya TS, Gromova ES, Shabarova ZA & Bhagwat AS (1993) The cysteine conserved among DNA cytosine methylases i...

Ngày tải lên: 19/02/2014, 00:20

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP 1 2 3 1 1 2 3 { } 324 X ...  X a X d X b X a X b X d ≺ X a ≺ X b ≺ X c ≺ X d ≺ X e X d ≺ X a ≺ X b ≺ X c ≺ X e X d     ≺  ≺   ≺  ≺    d(Y  , Y  ) 326      ❄ ❳ ❳ ❳ ❳ ❳③ ✘ ✘ ✘ ✘ ✘✾ ❄❄ ❄ ❄ X a ⇒ .....

Ngày tải lên: 20/02/2014, 07:20

... that protein family. In addition, we show that both its fold and potential surface partially resemble the structural features of the antimammalian scorpion a- neurotoxins and of the human antibacterial ... the inactivation of the Na + channel in a fashion similar to that of scorpion a- toxins [11], other experiments have shown that, at low doses, it has an analgesic activity invol...

Ngày tải lên: 20/02/2014, 11:20