Tài liệu Báo cáo khoa học: Catalytic mechanism of SGAP, a double-zinc aminopeptidase from Streptomyces griseus pdf

... structural data, a general catalytic mechanism was proposed for aminopeptidases thatinvolves an acidic residue acting as a general acid ⁄ gen-eral base and a di-nuclear metal center participating ... in catalysis.AbbreviationsAAP, Aeromonas proteolytica aminopeptidase; blLAP, bovine lens leucine aminopeptidase; Leu-pNA, leucine-para-nitroanilide; SGAP, Streptomyces griseus aminopeptidase. 3864 ... FEBS Catalytic mechanism of SGAP, a double-zinc aminopeptidase from Streptomyces griseus Yifat F. Hershcovitz1, Rotem Gilboa2, Vera Reiland2, Gil Shoham2and Yuval Shoham11 Department of...

Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf

... structure andcatalysis. Biochemistry 48, 3417–3424.31 Nakamura T, Matsumura H, Inoue T, Kai Y, UegakiK, Hagihara Y, Ataka M & Ishikawa K (2005)Crystallization and preliminary X-ray diffractionanalysis ... Nakamura T, Yamamoto T, Abe M, Matsumura H,Hagihara Y, Goto T, Yamaguchi T & Inoue T. (2008)Oxidation of archaeal peroxiredoxin involves a hyperva-lent sulfur intermediate. Proc Natl Acad ... Inoue T, Matsumura H,Kobayashi A, Hagihara Y, Uegaki K, Ataka M, Kai Y& Ishikawa K (2006) Crystal structure of thioredoxinperoxidase from aerobic hyperthermophilic archaeonAeropyrum pernix...

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

... N.N. & Braunstein, A. E. (1947)Labilization of a- hydrogen of amino acids under the action of aminoferase. Biokhimia 12, 556–568 (in Russian).2. Esaki, N., Nakayuma, T., Sawada, S., Tanaka, ... The anchoring of a- carboxylateand a- amino group in the external aldimine deﬁnesautomatically the positions of the a- proton and the sidechain of any bound amino ac id. The lability of the a- protonobserved ... mechanism of a- proton isotope exchange in amino acids catalysedby tyrosine phenol-lyase1What is the role of quinonoid intermediates?Nicolai G. Faleev1, Tatyana V. Demidkina2, Marina A. ...

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccasesJuha P. Kallio1, Chiara Gasparetti2, Martina Andberg2, Harry Boer2, Anu Koivula2, Kristiina Kruus2,Juha ... observed for MaL, that may determinethe properties of these asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession ... copper-containing enzymes used in various applications, suchas textile bleaching. Several crystal structures of laccases from fungi andbacteria are available, but ascomycete types of fungal laccases...

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... atoms) and rjis the standard deviation of Bfactors. The normalized B factors have a zero mean and unitvariance. All atoms that satisfy Bz‡ 4 are treated as outliersand discarded. After ... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma-tional rearrangement that exposes the NLS in an extended conformation.DatabaseStructural data are available in ... supernatant was added to a 3-mL solution of eithernickel nitrilotriacetic acid agarose resin (Qiagen, Valencia,CA, USA) or Proﬁnity immobilized metal afﬁnity chro-matography (IMAC) resin (Bio-Rad,...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Bxe _A2 876 (accession numbergi:91782944) was ampliﬁed from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... Fe2+display a remarkablyconserved structure [2,17–19]. A facial triad of twohistidines and one carboxylate residue (aspartate orglutamate), exempliﬁed by the metal centers of a large class of 2-ketoglutarate-dependent...

Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx

... 341,335–351.3 Lacadena J, A ´lvarez-Garcı´ a E, Carreras-Sangra N,Herrero-Gala´n E, Alegre-Cebollada J, Garcı´ a- OrtegaL, On˜aderra M, Gavilanes JG & Martı´nez del Pozo A (2007) Fungal ribotoxins: ... Martı´nez-Ruiz A, Garcı´ a- Ortega L, Kao R, LacadenaJ, On˜aderra M, Manchen˜o JM, Davies J, Martı´nez delPozo A & Gavilanes JG (2001) RNase U2 and alpha-sarcin: a study of relationships. Meth ... were analyzed in a semi-automated iterative mannerby cyana 2.1 [38]. The NOE coordinates and intensitiesused as input for automated analysis were generated auto-matically by Sparky based on...

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... benzo [a] pyrene-2¢-deoxyguanosineadducts affects DNA methylation by SssI and HhaI DNAmethyltransferasesOksana M. Subach1, Diana V. Maltseva1, Anant Shastry2, Alexander Kolbanovskiy2,Saulius Klimasˇauskas3, ... Wyszynski MW, Gabbara S, Kubareva EA, RomanovaEA, Oretskaya TS, Gromova ES, Shabarova ZA &Bhagwat AS (1993) The cysteine conserved amongDNA cytosine methylases is required for methyl trans-fer, ... constant; M.SssI, SssI DNA methyltransferase;M.HhaI, HhaI DNA methyltransferase; MTase, DNA methyltransferase; V0, initial rate of methylation; Vmax, maximal rate of methylation.FEBS Journal...

Tài liệu Báo cáo khoa học: "Topological Ordering of Function Words in Hierarchical Phrase-based Translation" pdf

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP1 2 3 1123{ }324X ... X a XdXbX a XbXd≺X a ≺ Xb≺ Xc≺ Xd≺ XeXd≺ X a ≺ Xb≺ Xc≺ XeXd ≺  ≺  ≺  ≺ d(Y, Y)326    ❄❳❳❳❳❳③✘✘✘✘✘✾❄❄ ❄ ❄X a ⇒ ... ∼) =ifλiifiλi˜e˜fPtrans(˜f|˜e) Ptrans(˜e|˜f)Plex(˜f|˜e) Plex(˜e|˜f)eD∗eD∗= P (D), D e.D = Xi, i ∈ 1 |D|325X a →    X1, X1Xb→ X1 X2,...

Tài liệu Báo cáo khoa học: Solution structure of crotamine, a Na+ channel affecting toxin from Crotalus durissus terriﬁcus venom docx

... that protein family.In addition, we show that both its fold and potentialsurface partially resemble the structural features of theantimammalian scorpion a- neurotoxins and of the humanantibacterial ... theinactivation of the Na+channel in a fashion similar to that of scorpion a- toxins [11], other experiments have shown that, atlow doses, it has an analgesic activity involving both centraland ... Kobayashi, Y., Sato, A. , Takashima, H., Kyogoku, Y., Lambert,P., Kuroda, H., Chino, M., Watanabe, T.X., Kimuka, T.,Sakakibara, S. & Morodor, L. (1991) The cysteine stabilized a helix: a...

Xem thêm