0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease a common pathway? docx

... MINIREVIEW Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease a common pathway? Julia C. Fitzgerald and Helene Plun-FavreauDepartment ... Parkinson’s disease. Lancet Neurol 7,9 7–1 09.4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai-to M, Maruyama M, Takahashi T, Ozawa T, Tsuji S &Takahashi H (2000) An autopsy case of autosomal-recessive ... ofParkin, PINK1, DJ-1 and HtrA2 activity remains tobe determined.Parkin can be phosphorylated by a number of kinasesincluding casein kinase 1, protein kinase A, proteinkinase C [86] and...
  • 9
  • 775
  • 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx

... substantia nigra. In addition,typical PD cases have intracellular proteinaceous inclu-sions called Lewy bodies and Lewy neurites in thebrainstem and cortical areas. Genetic research in the past ... & Millat G (2003) Niemann–Pick disease type C. Clin Genet 64, 26 9–2 81.27 Tamura H, Takahashi T, Ban N, Torisu H, NinomiyaH, Takada G & Inagaki N (2006) Niemann–Pick typeC disease: novel ... mutations in ATP1 3A2 ,encoding a lysosomal type 5 P-type ATPase. Nat Genet38, 118 4–1 191.34 Najim al-Din AS, Wriekat A, Mubaidin A, Dasouki M& Hiari M (1994) Pallido-pyramidal degeneration,supranuclear...
  • 7
  • 652
  • 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB 3 (5¢-AAA AGA ATT CTT AGAAGT CCC AGT CAT CGT C-3¢; additional EcoRI siteunderlined).The amplified PCR fragment (Taq ... nrdF+gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, NC, USA) ... ⁄ PAGE [48] in a mini-gel system (BiometraGmbH, Go¨ttingen, Germany). Coomassie stained proteinbands were compared with protein molecular weight stan-dards (Amersham Pharmacia, Piscataway,...
  • 14
  • 872
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACPEP4_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R ... CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 ... AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGCATH1_pLC1 TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTTAATCATTGAGAACAATTTCCTTGATTGS....
  • 15
  • 475
  • 0
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

... rat brain. J Neurosci Res58, 26 2–2 69.31 Kamiike W, Shimizu S, Hatanaka N, Morimoto Y,Miyata M, Yoshida Y & Matsuda H (1994) Hypoxia–reoxygenation causes DNA damage in hepatocytes.Transplant ... brain. Generally, this a- keto acid isassociated with protective effects against hypoxia andreoxygenation. This is mainly ascribed to its ability tomaintain redox status [17], intervening in ... 2ADP + Pi 2ATP2×FADH, H+ CytosolGlutamate5-Oxoprolineγ-Glutamyl-cysteineCysteine GlycineADP + Pi + ATP + ATPADP + Pi GlutamineGS-X(conjugate)Amino acids (AA)γ-Glutamyl-AACysteinyl-glycineγ-Glutamyl-AACysteinylglycineconjugateExtracellular...
  • 11
  • 479
  • 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... Egelman EH (1999) Human Dmc1 protein bindsDNA as an octameric ring. Proc Natl Acad Sci USA 96,1068 4–1 0688.39 Masson JY, Davies AA, Hajibagheri N, Van Dyck E,Benson FE, Stasiak AZ, Stasiak A & ... Proc Natl Acad Sci USA93, 623 6–6 240.11 Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O,Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y& Takeda S (1998) Rad51-deficient vertebrate cells accu-mulate ... 28 7–2 93.22 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K,Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S(2004) Structural basis for octameric ring formation andDNA interaction of the human homologous-pairingprotein...
  • 12
  • 662
  • 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

... B2-linker-ATTCATACCGAAAAGACCC ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTCATGTTAATTGTAACGGCATCGATGAATTCGAGCTCGALR2-up ... ATGCGGCCGCGTCGACGATTGTAACGALR2-SacI-f TTTCTGCAGGAGCTCGAAAAATGCAGCATTTGGALR2-PstI-r AAACTGCAGGATTGTAACGGCTATATCTACE Alr1-rtp CAGGGTATGGATGAAACGGTTGCAlr1-rtm TGATCCCGAAGTGGAAGTAGAGCAlr2-rtp TTAAGTTCTAATGCGAGGCCATCCAlr2-rtm ... TTCGAAAAATGCAGCATTHIS3-r TCTACAAAAGCCCTCCTACCD ALR2mutR-EforCCAGGAGAGAATTCAAGTATTGCALR2mutR-ErevGCAATACTTGAATTCTCTCCTGGALR2-5¢SacII-f ATTGCAGTTGTCCALR2-SalI-r ATGCGGCCGCGTCGACGATTGTAACGALR2-SacI-f...
  • 14
  • 607
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... PKRand 2¢5¢OAS also contain potential GAS-like elements,ISGF3-independent STAT2-containing complexesdependent on a functional STAT2 DNA bindingdomain do not appear to play an important role in mediating ... differentially regulated by inter-feron alpha, beta, or gamma using oligonucleotidearrays. Proc Natl Acad Sci USA 95, 1562 3–1 5628.21 Hannigan GE & Williams BR (1992) Interferon-alphaactivates ... interferon receptor(IFNAR), activates multiple intracellular signalingcascades that coordinate to trigger both the tran-scriptional activation and translational modificationsnecessary to invoke...
  • 13
  • 459
  • 0
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

... and Wilkins, Phila-delphia, PA, USA.11 Johnson G & Wu TT (2000) Kabat database and itsapplications: 30 years after the first variability plot.Nucleic Acids Res 28, 21 4–2 18.12 Martin AC ... with a modification in the mathematicalprocessing of the raw data, as previously described [48].The measurements were performed at 25 °C in NaCl ⁄ Picontaining 1% BSA. Fab4E11-H6 at a constant ... re -emerging, viral andtransmitted by the Aedes mosquitoes. Approximately100 million individuals are affected by the disease annually and one billion are at risk, mainly in the sub-tropical...
  • 13
  • 658
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam