x5 confers long term resistance to hiv 1 in human cd4 t cells
Báo cáo y học: "Comparative biochemical analysis of recombinant reverse transcriptase enzymes of HIV-1 subtype B and subtype " ppt
Ngày tải lên :
13/08/2014, 01:20
... active site of RT, acting as competitive inhibitors of RT and interfering with the addition of incoming nucleosides to growing viral DNA chains The NNRTIs are non-competitive inhibitors that bind ... GACGTCTTATAACGATCGCCCTTAAGCCGCGC 3’-GACGTCTTATAACGATCGCCCTTAAGCCGCGC-5’ B RNase H activity w/o trap B RT C RT RNase H activity w/ trap B RT C RT -18 -15 -7 0.5 0 1 15 1. 5 0 1 15 1 0.5 1. 5 1. 5 0.5 15 1 15 (min) 0.5 1. 5 Figure ... 5’-CGTTGGGAGTGAATTAGCCCTTCCAGTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGA-3’; kim40R, 5’-AAGCTTGGCTGCAGAATATTGCTAGCGGGAATTCGGCGCG-3’; kim32D, 5’-CGCGCCGAATTCCCGCTAGCAATATTCTGCAG-3’; Tenofovir (TFV) and tenofovir diphosphate (TFV-DP) were kindly...
- 11
- 241
- 0
Báo cáo Y học: The processivity and fidelity of DNA synthesis exhibited by the reverse transcriptase of bovine leukemia virus pot
Ngày tải lên :
31/03/2014, 21:21
... 51 10 0 10 1–200 200–700 Overall extension Relative processivity HIV- 1 RT MLV RT Without trap With trap Without trap With trap Without trap With trap 12 .3 15 .4 27.3 5.6 60.6 30.2 1. 4 1. 0 0 .1 32.7 ... 16 –50 51 10 0 10 1–200 200–700 Overall extension Relative processivity HIV- 1 RT MLV RT Without trap With trap Without trap With trap Without trap With trap 3.3 9.3 33.2 22.5 68.3 12 .4 1. 3 1. 8 0.8 16 .3 ... of the products are in this length range This difference between BLV RT and the two other RTs suggests that BLV RT has weaker binding to the DNA substrate than the other RTs studied It might also...
- 9
- 459
- 0
the nitro group in organic synthesis 2001 by noboru ono
Ngày tải lên :
09/05/2014, 17:07
... synthetic method for nitroalkanes and α-nitro esters However, ethyl bromoacetate is exceptional in that it fails to give ethyl nitroacetate on treatment with sodium nitrite.93 This is due to the ... α,ω-dinitroalkanes Thus, the potassium salt of 2,6-dinitrocyclohexanone is converted to 1, 5-dinitropentane in 78% yield on treatment with acid In a similar way, 1, 5-dinitropentane and 1, 4-dinitrobutane ... electron transfer from the silyl enol ether to tetranitromethane A fast homolytic coupling of the resultant cation radical of silyl enol ether with NO2 leads to α-nitro ketones Tetranitromethane...
- 383
- 321
- 0
Báo cáo y học: "Protein synthesis molecule by molecule" pot
Ngày tải lên :
14/08/2014, 16:21
... behavior to that observed by Yu et al [11 ] for protein production This similarity immediately leads to a possible alternative interpretation of the results by Yu et al [11 ]: that the observed characteristics ... the protein kinetics, thus appearing to us as a protein burst The existing data may not be sufficient to resolve this issue, and the experimental systems are quite different in detail It is, however, ... basis Although Yu et al [11 ] mention the localization of Tsr only in passing, noting that it first appears at random and then moves to the poles of the cell, the ability to observe single molecules...
- 3
- 77
- 0
Tài liệu Báo cáo khoa học: Kinetics of dextran-independent a-(1 fi 3)-glucan synthesis by Streptococcus sobrinus glucosyltransferase I pdf
Ngày tải lên :
14/02/2014, 22:20
... proteins The proteins used start at Asp85 of GTF-I and terminate at Ser1085 and Asn1592 for GS and GSGB, respectively Both proteins contain an extra peptide, TMITNSSSVPG, from the multiple cloning ... triangles) The lines indicate the curve fitted to the Michaelis–Menten equation to obtain Acc kcat and Km (Table 1) , with the nonlinear regression program in the ORIGIN software package (v 6.1J) The data ... Streptococcus mutans strain OMZ176 J Gen Microbiol 12 9, 7 51 754 11 Kato C, Nakano Y, Lis M & Kuramitsu HK (19 90) Carboxyl-terminal deletion analysis of the Streptococcus 15 16 17 18 19 20 21 22...
- 10
- 661
- 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc
Ngày tải lên :
16/02/2014, 09:20
... reaction rate under physiological intracellular concentrations of substrates needs to be determined to demonstrate that 506 H thermophilus POR functions toward pyruvate synthesis in vivo To investigate ... attacks the carbonyl carbon of acetyl-CoA (as it attacks the carbonyl carbon of pyruvate in the oxidative decarboxylation) to form a transient tetrahedral intermediate (3) The tetrahedral intermediate ... (data not shown), indicating that electron transfer from external electron donors is a key step to initiate the carboxylation reaction To supply reducing equivalents to POR via ferredoxin, we utilized...
- 10
- 619
- 1
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
Ngày tải lên :
19/02/2014, 06:20
... effects on the sensitivity of cells to TRAIL-induced downregulation of protein synthesis Our data indicate that IFNa treatment sensitizes both MCF-7 and HeLa cells to the translational inhibitory ... HeLa cells Our data therefore suggest that the degree to which this apical caspase is activated determines not only the extent of apoptosis but also the ability of TRAIL to regulate the initiation ... proapoptotic in their own right [8 12 ], but more usually these cytokines are cytostatic rather than cytotoxic when applied as single agents [13 ,14 ] However, numerous reports indicate that prior treatment...
- 11
- 679
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
Ngày tải lên :
19/02/2014, 16:20
... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC ... efficiently as the ompA 117 mRNA fragment which contains an Hfq binding site implicated in translation and stability of this mRNA (Fig 3) These data may indicate either that structural determinants ... conclude that the presence of secondary structures at both extremities of the potential Hfq binding site may limit the number of Hfq molecules susceptible to interact with the RNA, but that the position...
- 10
- 488
- 0
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt
Ngày tải lên :
21/02/2014, 01:21
... precipitation The amount of radioactivity determined in those precipitates is the parameter used to determine the poly(A) polymerase activity [12 18 ] Potential reaction products that not precipitate ... preferentially in the reaction mixtures containing the effectors (Fig 4B) From the radioactivity present in the AMP spot, the relative capacity of diguanosine polyphosphates to stimulate the synthesis ... mainly into a radioactive spot Ó FEBS 2002 retained at the origin of the TLC plate, a position that could correspond to poly(A) chain(s) In addition, the chromatographic pattern of the radioactive...
- 7
- 475
- 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx
Ngày tải lên :
22/02/2014, 04:20
... 0.8 nmol PtdInsÆmg )1 min )1 at mM EDTA, increasing to nmol PtdInsÆmg )1 min )1 between 2.5 and mM EDTA and a drop to at 10 mM Abolition of all exchange activity at 10 mM EDTA shows that the process ... period total lipids were extracted and the amount of labelled PtdIns was determined (Table 1) In the absence of CMP, the presence of AtPIS1 allows the incorporation of labelled inositol into PtdIns, ... correspondingly increased to 7.5 mM to compensate the chelating effect of EDTA (unpublished results) We therefore investigated the effect of EDTA on the reactions catalysed by PtdIns synthase in the...
- 6
- 551
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
Ngày tải lên :
06/03/2014, 00:20
... for the authentic PHCP protein, indicating the covalent attachment of the heme to the protein through two thioether bonds Discussion In this study, we attempted to determine whether or not Ambler’s ... bacteria The N-terminal amino acid sequence of PHCP was determined up to the 30th residue, as illustrated in Fig A blast search indicated that the protein sequence determined up to the 30th residue ... the authentic PHCP protein Visible absorption spectra of the authentic PHCP protein purified from H thermoluteolus were obtained to examine the local heme environment in the protein interior The...
- 8
- 606
- 0
Báo cáo khoa học: Iron regulatory protein-independent regulation of ferritin synthesis by nitrogen monoxide pot
Ngày tải lên :
07/03/2014, 12:20
... has to become associated with ribosomes, forming polysomes IRP binding to the IRE on the 5¢-UTR of ferritin mRNA prevents translation of the protein In this report we demonstrate that treatment ... which, in turn, triggers the ubiquitination and degradation of the protein [35] It has, however, been suggested that the ability of SNP to both stimulate IRP2 degradation and induce ferritin synthesis ... promotes the oxidation of ferrous iron [9] By contrast, the L-subunit has a higher capacity than the H-subunit to induce iron-core nucleation [10 ,11 ], suggesting that both ferritin chains cooperate in...
- 9
- 293
- 0
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
Ngày tải lên :
07/03/2014, 12:20
... Combinatorial [15 N]-labelling depends on suppression of transamination reactions that would otherwise obscure the labelling pattern Thus, an early attempt of combinatorial labelling in vivo had to ... proteomics Nat Methods 1, 14 9 15 3 Kainosho M, Torizawa T, Iwashita Y, Terauchi T, Ono AM & Guntert P (2006) Optimal isotope labelling for ¨ NMR protein structure determinations Nature 440, 52–57 ... 273 (2006) 415 4– 415 9 ª 2006 The Authors Journal compilation ª 2006 FEBS 15 K Ozawa et al 10 11 12 13 14 15 16 17 Nureki O & Yokoyama S (20 01) Selenomethionine incorporation into a protein by cell-free...
- 6
- 461
- 0
Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx
Ngày tải lên :
07/03/2014, 12:20
... 5¢—CTCCGGGCC TTCTTTTTGGTCA—3¢; cPLA2 forward, 5¢—CATAAGT TTACTGTTGTGGTTCTA—3¢; cPLA2 reverse, 5¢—AGT GTCTCGTTCGCTTCC—3¢; COX-2 forward, 5¢—CCATG GGTGTGAAGGGAAATAA—3¢; COX-2 reverse, 5¢—TTG AAAAACTGATGGGTGAAG—3¢; ... address this question we constructed a luciferase reporter construct consisting of seven LexA binding sites upstream of a TATA-Initiator (TATA-Inr) module without any additional promoter elements This ... ⁄ intracrine signaling loop upon activation of Raf We therefore investigated whether 4-OHT treatment of N-BxB-ER cells would lead to an activation of the transcriptional activity of PPARb To...
- 10
- 434
- 0
Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot
Ngày tải lên :
07/03/2014, 16:20
... but it is not understood how the tRNA is directed to the A-site in the cell The data presented here does not support the hypothesis that SF directs unacylated tRNA to the ribosomal A-site for the ... it intriguing that the order of addition of tRNA and SF to the activity assay affected the tRNAsaturation curve This suggested that SF might form a complex with unacylated tRNA in solution that ... mulated SF to the same extent upon addition of tRNAPhe to the activity assay (results not shown) Binding of tRNAMet to ribosomes f Binding of tRNAMet to T4 -mRNA programmed ribof somes did not increase...
- 11
- 446
- 0
Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx
Ngày tải lên :
07/03/2014, 17:20
... maltotriose to maltoheptaose No maltose was detected, either in the supernatant or in the cell extracts, following incubation with glucose Maltose was not detected in cell extracts following incubation ... 6A,B This showed that maltotriose and maltotetraose, which were also transported into the bacteria, were used to synthesize longer MDs: these MDs (mainly maltotetraose, maltopentaose and maltohexaose, ... maltotetraose (C) Samples taken at the same time-points were applied to the TLC Glc, glucose; M2, maltose; M3, maltotriose; M4, maltotetraose; M5, maltopentaose; M6, maltohexaose; Spot 1, Spot...
- 12
- 406
- 0
Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc
Ngày tải lên :
08/03/2014, 09:20
... distribution of HA produced by FM100 cells This suggests that MU acts to inhibit the HA synthesis pathway but not to stimulate the HA degradation pathway In the present study, we showed that MU ... and stained with anti-spHAS antibody according to the method of Towbin et al [35] using 3,3¢-diaminobenzidine tetrahydrochloride (Dojindo Laboratories, Kumamoto, Japan) for detection Resulting ... CL to rescue inhibited, DDMsolubilized HAS suggests that the enzyme in the membranes of MU-treated cells, is inactive because it is unable to interact with CL species that are able to activate...
- 10
- 541
- 0
Báo cáo Y học: Concerted regulation of free arachidonic acid and hormone-induced steroid synthesis by acyl-CoA thioesterases and acyl-CoA synthetases in adrenal cells pdf
Ngày tải lên :
08/03/2014, 09:20
... 22R-OH-cholesterol by-passes the effect of the inhibitors strongly indicates that the thioesterase and the acyl CoA-synthetase act in the same signalling pathway in a step prior to the rate-limiting passage ... triplicate activity in vitro Figure shows that a 5-min preincubation of recombinant protein with NDGA inhibited thioesterase activity Interestingly, NDGA produced only a 20% inhibition of the mitochondrial ... possibility is supported by our previous results showing that antibodies raised against a synthetic peptide matching a sequence that contains the serine included in the catalytic triad inhibit steroid...
- 9
- 470
- 0
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
Ngày tải lên :
16/03/2014, 14:20
... GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢ DNA concentrations are expressed as total nucleotide concentrations The oligonucleotide used in the current study was ... to diminish and that of higher oligomeric forms that enter into the gel (as labelled in Fig 1A) appear to increase in sets containing nucleotide cofactors This trend is consistent with ATP induced ... role in the recruitment of hRad 51 to ssDNA The results described in this study help us to understand the transitions associated with the oligomeric states of hRad 51 and hRad52 proteins in the...
- 9
- 378
- 0
Báo cáo khoa học: Methylene analogues of adenosine 5¢-tetraphosphate Their chemical synthesis and recognition by human and plant mononucleoside tetraphosphatases and dinucleoside tetraphosphatases pot
Ngày tải lên :
16/03/2014, 14:20
... weaker inhibitors than their d-phosphate homologues Altogether, it is evident that both the adenine ring and the length of the polyphosphate chain contribute to the strength of binding of the mononucleoside ... (1 mm) into ATP This unexpected result suggests that the active sites of these three enzymes recognize and bind only nucleotides with tetraphosphate chains having intact P–O–P bridges, even though ... estimate reaction rates, 0.005 mL aliquots were spotted on to TLC plates (aluminium plates precoated with silica gel containing fluorescent indicator; Merck cat no 5554), usually after 6, 12 , 18 ...
- 10
- 501
- 0