Ngày tải lên: 26/12/2014, 08:36
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
... independently. The teacher is the monitor and the facilitator. The teacher is the monitor and the facilitator. Every member in the group has to take part in Every member in the group has to take part in ... correction Marks Marks Having enough partners’ ideas Having enough partners’ ideas 5 5 Right as the ideas are led Right as the ideas are led 7 7 Completing the group’s duty Completing the group’s duty 7 7 Having ... their work going to each of the family in their their work going to each of the family in their neighbour to take the notes of the amount of neighbour to take the notes of the amount of energy...
Ngày tải lên: 22/07/2013, 01:27
What is the price of a mousetrap? The assessment of value from cloud services pptx
... solution. The latter has the additional attributes of being available anywhere, at anytime and on any device. If it was only a simple as a mouse-trap. The complication is that for most customers they ... corporation Conclusion In this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This is a timely discourse as the ... the traditional performance measure are absurd. It is pure guesswork to forecast IT demand over a multi-year period and translate that back to IT costs. How many and what types of servers are...
Ngày tải lên: 09/03/2014, 02:20
in prostate tests psa what is the difference between total psa and free psa
... that there is no prostate cancer? Doesn’t the existence of any PSA means that the body is reacting with antibodies against cancerous cells in the prostate. PSA starts out in the fluid that carries ... In prostate tests PSA what is the difference between total PSA and free PSA? What is the normal range? In addition, how can it be that if there is ANY prostate specific antigen in the blood ... prostate enlargement, inflammation, infection, age, and race. If there are no other indicators that suggest cancer, the doctor may recommend repeating DRE (digital rectal examination) and PSA...
Ngày tải lên: 21/03/2014, 12:19
What is the impact of microfinance on poor people? a sysTemaTic review of evidence from sub-saharan africa pptx
... Practice Information and coordinating Centre FINCA Foundation for International Community Assistance FSDT Financial Sector Deepening Trusts in Kenya and Tanzania GHAMFIN Ghana Microfinance Institutions ... were of savings schemes alone. They include evaluations of programmes within Ethiopia, Ghana, Kenya, Madagascar, Malawi, Rwanda, South Africa, Tanzania (Zanzibar), Uganda and Zimbabwe. Ten ... African countries, namely Cameroon, Ethiopia, Ghana, Kenya, Ivory Coast, Madagascar, Malawi, Nigeria, Rwanda, South Africa, Tanzania, Uganda, Zambia and Zimbabwe. One study also included data...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut E Mut F Mut G Mut H Mut I ABCDEFG ... to LIN54 [34]. Although A B MYB2 MYB3 MYB4 MYB5 E2F CAAT CAAT CDE CHR MYB1CHR ABCDE GHIF ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAGATCT CHRup MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut...
Ngày tải lên: 23/03/2014, 04:20
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt
... curriculum as their top picks. Canada also highly valued individual attention, as did Italy at 50% and the United Kingdom at 41%. Brazil, India and Spain chose having an innovative teaching/learning ... animator. They also state the importance of creating and maintaining a professional network. One in ve animators say they have a mentor at work, while having a mentor is in the top three recommendations ... which came in at 21%. When we asked what was most important in getting a quality animation education, the two areas that tied at 23% were the quality of the curriculum, and having an innovative...
Ngày tải lên: 31/03/2014, 15:20
– GED SOCIAL STUDIES PRACTICE QUESTIONS – 29. What is the author’s purpose in including Joe pot
... potential to kinetic, and back to potential. When the hanging weight is at one of the high points, the gravitational potential energy is at the maximum, and kinetic energy is at the minimum. At the ... Mat- ter can also refract or bend waves. This is what happens when a ray of light traveling through air hits a water sur- face. A part of the wave is reflected, and a part is refracted into the water. Maximum ... by the passage. 53. b. Ch in Shih Huang-ti abolished the aristocracy of feudalism, instead appointing officials to carry out his rules in all of China’s provinces. 54. e. The Ch in Dynasty introduced...
Ngày tải lên: 18/06/2014, 17:20
Cutting Tool Materials What is the use of a book docx
... onto an uncomplicated tooling database for later in- terrogation. Having established the current status of the tool- ing within the manufacturing facility, this allows for a tooling rationalisation ... machining operations it can be considered as a ultra-hard cutting tool, it was rst synthesised in the late 1950’s. In many ways, CBN and natural diamond are very similar materials, as they ... Parts, American Machinist, May 1996. Raymond, M.K. Coatings Keep Cutting Tools Sharp. Ameri- can Machinist, 40–42, May 1996. Richter, A. Raising Al – AlTiN Coatings. Cutting Tool Engg., 42–46, Jan.,...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: "Value of anti-infective chemoprophylaxis in primary systemic vasculitis: what is the evidence" pdf
... treatment in a large GCA trial and increased infection-related mortality. Rising awareness of GC complications, including infections, makes GC sparing an increasingly important aim. According to ... promotes infections but has a role in the aetiology of the disease itself [44]. Disease stage and phase of therapy In PSV, and especially in SVV, the therapeutic approach usually consists of an induction ... non- absorbable and associated, therefore, with very few side effects. According to a meta-analysis, the non-absorbable nystatin is not more effective in avoiding fungal colonisation than placebo and can...
Ngày tải lên: 09/08/2014, 14:22
báo cáo khoa học: "What is the value and impact of quality and safety teams? A scoping review" potx
... have increased reporting after training program, rather than the intervention being efficacious; unclear as to whether there was a change in intervention midway or after training program. Harris ... understanding of how these teams are established, the barriers and facilitators to establishing and imple- menting teams and team initiatives, as well as the strength of the evidence about the impact ... undertaken to understand the types of quality and safe team initiatives, the evidence about their impact, and the barriers and facilitators to estab- lishing teams and team initiatives. Methods Data...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "What is the role of surfactant and inhaled nitric oxide in lung transplantation" pps
... an increased small aggregate/large aggregate ratio in lavage of transplanted lungs. This finding led to the hypothesis that leakage of plasma protein into the alveolar space may inhibit surface-active ... reperfusion injury after lung transplantation and successful treatment using a combination of inhaled nitric oxide (iNO) and surfactant instillation. What is the role of surfactant in management of initially ... initially impaired graft function after lung transplantation, and do these findings apply to other forms of lung injury? Ischaemia/reperfusion injury leading to initial graft failure is a major cause...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "What is the best site for central venous catheter insertion in critically ill patients" doc
Ngày tải lên: 12/08/2014, 19:22
Báo cáo khoa học: " Science review: Carnitine in the treatment of valproic acid-induced toxicity – what is the evidence" pot
Ngày tải lên: 12/08/2014, 22:22
Báo cáo y học: " Intensive glycemic control in traumatic brain injury: what is the ideal glucose range" pps
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: " Recombinant human activated protein C in acute lung injury: what is the role of bronchial circulation" docx
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Clinical review: What is the role for autopsy in the ICU" doc
Ngày tải lên: 13/08/2014, 20:21
What is the real MLM business?
... how a particular company is designed and managed. Since the MLM industry is very young (about 40 years old), the law is still in flux. There are admittedly many MLM companies that are nothing ... in the same place - AT THE BOTTOM - and everyone has the SAME chance to build a downline of their own. The major exception to this is in the theoretical case of "saturation." In this ... who joins the mature company has MANY more tools and support mechanisms available to him/her than the "old hands" did back at the start of the company. There are probably also many...
Ngày tải lên: 22/10/2012, 14:02