water partition as a surrogate

... potential and various parameters such as water solubility, octanol water partition, and relative mobility on reversed-phase chromatographic systems have been demonstrated, and may be considered satisfactory ... carbon content of the sediment, was not due to lipase, protease activity, or esterase activities, and was attributed to surfactant activity It was correlated with traditional estimates of bioavailability ... water phase together with biota (e.g., algae and fish) and particulate material (seston), while the term aqueous phase will be applied in a more restricted sense to the water phase alone A valuable...

Ngày tải lên: 11/08/2014, 04:20

... software written specifically for the personal computer 90 FEDERAL RESERVE BANK OF KANSAS CITY (BASIC) was developed and marketed by Paul Allen and Bill Gates as part of a small business, Traf-O-Data, ... former case and (relative) job dissatisfaction in the latter Tabulations show a consistent downward trend in annual rates of permanent job separations as firm size increases (Anderson and Meyer) ... Bureau Note: NA indicates that data were not available 84 FEDERAL RESERVE BANK OF KANSAS CITY Many explanations for the size-wage effect have been explored with little success Lacking a satisfying...

Ngày tải lên: 06/03/2014, 19:20

... they were assigned at the time of the study Materials Materials selection A female graduate teaching assistant whose L1 is American English was video-recorded giving a lecture, ‘‘Ceramics for ... of Speech, Language, and Hearing Research, 24, 526–539 Lazaraton, A (2004) Gesture and speech in the vocabulary explanations of one ESL teacher: A microanalytic inquiry Language Learning, 54, ... with Massaro’s (1998) argument that speech information can be acquired without direct fixation of one’s gaze Gestures and facial cues may facilitate face-to-face interactions involving L2 learners...

Ngày tải lên: 10/03/2014, 05:20

... (Government Savings Bank) has a “School Based Savings Programme” in which students recreate a savings bank in their class and acquire the basic principles of personal financial management via a “learning ... addition, bank fees to hold an account often exceed interest paid for small deposit accounts In contrast, at the postal savings bank in Benin, Burkina-Faso, Kenya and Tanzania, people can open a savings ... future payment capacity and is not based on collaterals Personal references and overall household expenses are part of the credit analysis FEATURE ARTICLES People’s Bank Program: This was established...

Ngày tải lên: 15/03/2014, 10:20

... associated with caveolae Caveolae are defined as small invaginations of the plasma membrane associated with lipid rafts that contain caveolin-1 [26,27] Similar to caveolae, endo-lysosomal compartments ... multifunctional enzymes in cancer Nat Rev Cancer 2006, 6:764-775 Ohashi N, Yamamoto T, Uchida C, Togawa A, Fukasawa H, Fujigaki Y, Suzuki S, Kitagawa K, Hattori T, Oda T, et al.: Transcriptional induction ... proteases and not pH may be responsible for changes leading to infection Cysteine proteases function as intracellular and extracellular molecules [25] The cysteine protease cathepsin B is associated...

Ngày tải lên: 12/08/2014, 04:21

... measure the gap among prefectures was 0.075 ( 2003, data for an advisory council, Ministry of Land, Infrastructure and Transport) so, the regional divide was relatively small This indicates that ... Okinawa, Miyazaki and Nagasaki Japan consists of 47 prefectures) by using statistical data on the size of the enterprise and prefectural income (typical index that measure the wealth gap between ... latter half of the 1960’s, a comparatively remarkable increase in the number of SMEs with a capital scale of 1-5 million yen becomes apparent, and from the latter half of the 1970’s, an increased...

Ngày tải lên: 01/11/2014, 22:05

... Pollen Name Arecastrum romanzo ffianum (Palm,Queen) Atriplex polycarpa(Allscale) Avena sativa (Oats, cultivated) Baccharis halimifolia(Bacchairs,eastern) Baccharis sarothroides(Baccharis,western) ... Cladosporium cladosporoides2 Cladosporium fulvum Cladosporium herbarum2 Corenyspora cassiicola1 Curvularia brachyspora1 Curvularia fallax1 Curvularia inequalis1 Curvularia lunata1 Curvularia pallescences1 ... Statistical Analysis The data analysis was done with the program of SAS 8.02 ANOVA was used for the analysis of the transfer efficiency and for the evaluation of washing effects of the immunoarray...

Ngày tải lên: 16/09/2015, 17:13

... Jameekornrak A, Limwongse C, Sangasapaviliya A, Jirapongsananuruk O, Assawamakin A, Chaiyaratana N, Luangwedchakarn V, Thongnoppakhun W: Association between ADAM33 polymorphisms and asthma in a Thai ... [73] ADAM-12 ↗ asthma human [51] ADAM-17 ↗ asthma mouse [73] ↗ COPD rat [80] ADAM-28 ↗ asthma mouse [73] ADAM33 ↗ asthma human [57,71,82] SNP COPD human [79,83] ADAMTS-1 ↘ asthma human [51] ADAMTS-12 ... metalloprotease 33 (ADAM33) gene with asthma in ethnically diverse populations J Allergy Clin Immunol 2003, 112(4):717-722 Hirota T, Hasegawa K, Obara K, Matsuda A, Akahoshi M, Nakashima K, Shirakawa T,...

Ngày tải lên: 12/08/2014, 14:20

... drills, or actual management of major disasters in the Greater Houston area (upward of 25% of anything that the Federal Emergency Management Agency [FEMA] classifies as a disaster occurs in Harris ... initially regarding the pharmacy, case management, and nursing home placement As an obstacle was noted, it was addressed, and whatever measures were needed were taken in an incredible collaborative ... a shelter clinic or a hospital following a disaster have a potentially lifethreatening condition Communications are essential but are always a challenge All disaster response is local (at least...

Ngày tải lên: 12/08/2014, 23:20

... examination and CT scan Among the above nasal polyp patients, six patients had available nasal polyp tissue, sinus mucosa as well as the paired middle turbinate All of them were diagnosed as having ... It was also suggested that chronic sinusitis in Asian populations had a higher incidence rate of nasal polyps than in Caucasians due to the narrower nasal passages.19 A difference in the pathogenesis ... Precursor and mature B cells (no plasma cells) Anti-CD 1a DakoCytomation NA1/34 Langerhans cell Tryptase DakoCytomation AA1 Mast cell Neutrophil elastase DakoCytomation NP57 Neutrophil Major basic protein...

Ngày tải lên: 16/09/2015, 17:13

... of asthma The theory of systematic mediators has arisen, suggesting that asthma may be not a local but a systemic disease.42 Asthma, eczema and allergic rhinitis, are classically taken as 11 atopic ... with perennial rhinitis had NARES and four of them had nasal polyps The author suggested that NARES was a precursor to nasal polyps, asthma and aspirin intolerance Many factors may increase the risk ... role as many nasal polyp patients not have symptoms Diagnosis can only be made after endoscopic examination Nasal polyposis is a multifactorial disease which relates to many other diseases such as...

Ngày tải lên: 16/09/2015, 17:14

... mutant was prepared by overlap extension PCR [39], using the wild-type construct pET9d::LamA as template [6], with the primers 5Â-GCAAAG (sense) ATGGTGGTGGCATATGTAAGGGTTTAC-3Â and 5Â-GTAAACCCTTACATATGCCACCACCATCT ... 5Â-GTAAACCCTTACATATGCCACCACCATCT TTGC-3Â (antisense) The E5 3A mutant and the double mutant (E5 3A D28 7A) of pfLamA were produced using as primers 5Â-GCACGATGCGTTTGAAGG-3Â, and its complementary oligonucleotide ... calcium addition was tted by nonlinear analysis using the caligator software [32] The v2 value as calculated by the program was used as the measure of the goodness-of-t All the precautions required...

Ngày tải lên: 30/03/2014, 04:20

... Dimerization PARP Cleaved caspase-3 Caspase-8 Caspase-3 Activation Caspase-8 P DNA fragmentation Cleaved PARP Cleavage 150 Cleaved caspase-3 Cleavage Activation Caspase-3 Cleavage Activation Fig ... executioner caspases [37,38] Initiator caspases not only activate executioner caspases, but also act as their substrates Initiator caspases are activated by caspase-3 and initiate a feedback amplification ... mitochondrial pathway [47] Caspase-9 is also cleaved by caspase-3 at another cleavage site However, this fragmentation does not have caspase activity It enhances the activation of other caspases by alleviating...

Ngày tải lên: 14/02/2014, 22:20

... 5¢-GATATG CAGGTCAACAGGAACCGCGCCAATGGCGCA ACC-3¢ The template used for amplification was the pKK233-2 plasmid containing Enterobacter cloacae MurA wild-type (for generation of the R120K single mutant) ... 5¢-GGT TGCGCCATTGGCGCGAAACCTGTTGACCTGC ATATC-3¢; 3¢-primer (R to K): 5¢-GATATGCAGGTCA ACAGGTTTCGCGCCAATGGCGCAACC-3¢; 5¢-primer (R to V): 5¢-GGTTGCGCCATTGGCGCGGTTCCTGT TGACCTGCATATC-3¢; 3¢-primer ... conformational change, we have recently completed a thermodynamic study of UDPNAG binding to MurA [13] Based on the analysis of the measured heat capacity changes (DCp), and on surface accessibility...

Ngày tải lên: 19/02/2014, 13:20

... United States GNI per Capita: http://www.worldbank.org/data/databytopic/GNIPC.pdf • Europe & Central Asia: Albania, Armenia, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Croatia, Czech ... Microsoft and Compaq has Performance Task NIH Basic Research Local research organizations International foundations USAID (major)/ CDC Bilateral donors Pharmaceutical companies Local agencies ... infrastructures—approaches that usually call for significant adaptation of American concepts THE CHANGING GLOBAL ENVIRONMENT AND APPROACHES TO FOREIGN ASSISTANCE Approaches to foreign assistance...

Ngày tải lên: 05/03/2014, 12:20

... includes a variety of relevant macroeconomic and financial sector data (financial soundness indicators and structural financial sector data), as well as information from stress tests and scenario analyses ... currency board arrangements in Bosnia, Bulgaria, Estonia, and Lithuania; horizontal exchange rate bands in Hungary and Slovenia; fixed exchange rates in Latvia, Macedonia, and Ukraine; crawling bands ... Countries (averages over 2000-2004) 40 Ukraine 30 Albania Latvia Bulgaria Real Growth of Credit Lithuania Russia Belarus Moldova 20 Hungary Croatia Estonia Romania 10 Slovenia Bosnia Macedonia Poland...

Ngày tải lên: 06/03/2014, 08:20

... genomic DNA using Phusion DNA polymerase (Finnzymes) and the synthetic oligonucleotide primers 5¢-AAAAAAGAATTCATGTCA GACCTCAGCACCGC-3¢ and 5¢-AAAAAAAGCTTTCA GGCGGAACGCAGCTC-3¢ (EcoRI and HindIII ... catalyse such reactions One class, acyl CoASH synthetases, recognize and activate fatty acids as acyl adenylates (acyl AMPs), and subsequently couple them to coenzyme A (CoASH) The second class, ... scintillation analyser (Packard Instruments, Meriden, CT, USA) Activity assay of DptE with CoASH Acyl CoASH synthetases ⁄ ligases are thought to catalyse the thioesterification of a fatty acid with...

Ngày tải lên: 07/03/2014, 04:20

... engagement may lead to better academic preparation and achievement This attitudinal and behavioral effect of having savings could be as important as or more important than the money itself in affecting ... (>$10,000) Has no savings for youth Has savings for youth Youth variables White Black Male Female Has no account Has an account Has school savings Percent Certain 73 Percent of Certain Youth Attending ... 2006) This variable ranges from 129 to 339 in the aggregate sample of youth (certain and uncertain youth) Analysis Plan In the case of survey data, common SAS syntax for analyzing logistical regression...

Ngày tải lên: 15/03/2014, 10:20

... primers bF24rv and bF57rv The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCAAAAACCAGCCCGGGATA GGC-3¢ ... relatively high amidase activity encountered in PA are not known The wild-type has a higher esterase/amidase ratio for phenylacetylated substrates than bF2 4A, whereas bF2 4A has a higher esterase/amidase ... the acyl donor and 30 mM of the a- lactam nucleophile Vs/Vh a Acyl donor Nucleophile Product WT bF2 4A WT bF2 4A HPGM HPGA PGM PGA HPGM HPGA PGM PGA 6-APA 6-APA 6-APA 6-APA 7-ADCA 7-ADCA 7-ADCA 7-ADCA...

Ngày tải lên: 17/03/2014, 23:20