using groups in a single domain

... class that returns a PhoneNumber and accepts a single Name parameter Implement this indexer in the same way as the first one (again note that PhoneNumber is a struct and therefore always has a ... indexers In the PhoneBook.cs source file, add a public read-only indexer that returns a Name and accepts a single PhoneNumber parameter to the PhoneBook class Leave the body of the get accessor blank ... item in the array that matches The first argument to IndexOf is the array to search through (phoneNumbers) The second argument to IndexOf is the item you are searching for IndexOf returns the integer...

Ngày tải lên: 24/12/2013, 09:16

... its internal state In the example above, the speech recogniser has to continuously add incoming audio frames to its internal state, Number dictation: a micro -domain Building a fully incremental ... Timo Baumann and Michaela Atterer for their contributions to the project, as well as Anna Iwanow and Angelika Adam for collecting and transcribing the data used in this paper 752 References Aist, ... Analysis Doctoral dissertation, Linköping University, Linköping, Sweden Witten, I H., & Frank, E (2005) Data Mining: Practical machine learning tools and techniques San Francisco: Morgan Kaufmann...

Ngày tải lên: 17/03/2014, 22:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 18/06/2014, 18:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 20/06/2014, 01:20

... Communications and Networking MAP New AR MN AAA server CN RS RA BU Authentication and binding registration AAA request AAA reply BA IP config and DAD Data flow Figure 4: HMIPv6 domain handover signaling call ... Old MAG AAA server LMA New MAG Bidirectional tunnel Data flow MN detaches Deregistration PBU Deregistration PBA AAA query AAA Reply PBU AAA query AAA reply PBA RA Bidirectional tunnel Retains Address ... another MN in the same MAG link In fact, DCONF and DDAD are not appreciable when the MN is already roaming in the PMIPv6 domain Delays are inevitable during vertical handover although they can...

Ngày tải lên: 21/06/2014, 17:20

... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... M Rassias, “On approximation of approximately linear mappings by linear mappings,” Journal of Functional Analysis, vol 46, no 1, pp 126–130, 1982 J M Rassias, “Solution of a problem of Ulam,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol...

Ngày tải lên: 22/06/2014, 06:20

... al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no...

Ngày tải lên: 10/08/2014, 23:20

... on findings at autopsy, aspiration or asphyxia, or asthma attack ARDS was clinically defined by meeting four criteria: acute onset; bilateral fluffy pulmonary infiltrates by x-ray; pulmonary artery ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after...

Ngày tải lên: 13/08/2014, 20:21

... dialogue, dialogue participants accomplish a given task by using shared domain knowledge Since a frame-based model is more 231 3.1 Evaluation Data sets and experimental settings We collected a ... phenomena using plan inference, a plan-based model is not easy to be applied to the real world applications because it is difficult to maintain plan recipes In this paper, we propose a statistical ... of speakers’ intentions; a pair of a current intention and a next intention) that are extracted from a sequence of utterances in a current dialogue • Domain knowledge-level feature: In a goaloriented...

Ngày tải lên: 17/03/2014, 02:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

... Preoperatively and postoperatively, joint inclination in the lateral view, radial inclination in the anteroposterior view, loss of radial length, as well as intra-articular steps were evaluated according ... visual analog scale [17] Additionally all patients completed the Gartland and Werley score [18] and the patient-rated wrist evaluation [19] Radiological analysis included fracture AO-classification ... disinfection and draping carried out A distal Henry approach was carried out in the interval between the flexor carpi radialis tendon and the radial artery The distal part of the pronator quadratus muscle...

Ngày tải lên: 20/06/2014, 04:20

... Pain In adult total avulsions (Cases and 2), pain persisted and had a grade of In C5,6 ruptures C7,8T1 avulsions, pain disappeared, but patients complained of a sensation of tingling on combined ... P, Gray C, Kerr G, Licina P, Nowitzke A, Perry C, Silburn PAS, Urquhart S, Geraghty T: Autologous olfactory ensheathing cell transplantation in human paraplegia: a 3year clinical trial Brain 2008, ... subscapular approach [32,33] (Fig 7), Carlstedt [8] was able to approach the laminae, facet joints and avulsed root stumps present within the spinal canal He was not able to reach those roots avulsed...

Ngày tải lên: 10/08/2014, 10:20

... TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation System (Yves et al., 1996) In this process, major toxic ... alone) Figure Schematic diagram of photocatalytic solar reactor - 39 - The dark reaction was initially carried out by injecting a sampling of TCE into the slurry of TiO2 to given a final solution of...

Ngày tải lên: 05/09/2013, 08:40

... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... on the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... sodium acetate concentrations were estimated using this linear correlation and their verification (by gas chromatograph analysis) are shown in Table The estimated error was less than %, in four...

Ngày tải lên: 05/09/2013, 08:40

... beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables subgroups ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with ... steam and process hot water demands are also equality constraints [19] The inequality constraints are represented by the allowable ranges of variation of the decision variables, presented in Table...

Ngày tải lên: 05/09/2013, 16:30

... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...

Ngày tải lên: 05/09/2013, 17:03

... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... on teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... wide range of academic subject areas and age groups suggests that the use of cooperative learning may be associated with gains on the following variables: Achievement Liking for school Inter-ethnic...

Ngày tải lên: 06/09/2013, 05:10

... as a lion As fierce as a tiger As slippery as an eel As slow as a tortoise As slow as a snail As stink as a polecat As thick as ants As wet as a drowned rat Like water off a duck’s back To fight ... legal, and literary It can be said that connotation can be seen as an additional meaning to denotation In general, both connotation and denotation are important to determine word meaning in a ... Piggy bank Raining cats and dogs A bull in a China shop A dark horse To work like a dog An early bird A quiet as a mouse A copy cat 10 Eats like a horse 11 Smell to a rat 12 Talk turkey 13 A book...

Ngày tải lên: 14/12/2013, 00:41

... Namespaces, variables, and constants using System; using System.Configuration; using System.Windows.Forms; using System.Text; using System.IO; using System.Data; using System.Data.SqlClient; private ... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns)...

Ngày tải lên: 21/01/2014, 11:20