using a web service as a data source

... chosen randomly from classes at a high school Most of them have already learnt English for at least four or five years all of the participants have the same educational and language background and ... the (marry) (12)…….of King Charles II to Catherine of Braganza It was her great love of tea that made it (fashion) (13)… It was believed that tea was good for people as it seemed to be capable ... vocabulary It is obvious that vocabulary plays an integral part in the process of acquiring a language in general and in learning English in particular It is a vital element because vocabulary

Ngày tải lên: 03/07/2022, 07:07

... 2002 Recirculating Aquaculture Systems Cayuga Aqua Ventures: Ithaca, NY, USA, van Rijn, J and Rivera G Aerobic and Anaerobic Biofiltration in an Aquaculture Unit-Nitrite Accumulation as a Result ... appropriate form of starch for a RAS We have found that supplementing a denitrification unit attached to a large-scale intensive closed marine RAS with granular starch was an effective approach for ... 2005) As these alternatives are costly and require an additional dosing mechanism, we suggest that there is both an economical and practical advantage to using granular starch to stimulate denitrification

Ngày tải lên: 27/09/2019, 10:31

... berkelanjutan Walaupun demikian masalah utama dalam pemeliharaan udang tanpa pergantian air adalah pengendalian unsur nitrogen anorganik terutama amonia dan nitrit Nitrogen tidak organik dalam budidaya ... RATIO LEVELS ON INORGANIC NITROGEN IN WATER USING MOLASSES AS A CARBON SOURCE Pohan Panjaitan ABSTRAK Pemeliharaaan udang dengan model tanpa pergantiaan air merupakan pengembangan industri udang ... budidaya udang dapat dikendalikan dengan cara penambahan sumber karbon misalnya molasses ke dalam media budidaya udang Walaupun demikian sebelum molasses diterapkan untuk pengendalian nitrogen dalam

Ngày tải lên: 18/10/2022, 21:33

... accepted as a valid alignment and raw data for all filter passbands are recorded To verify the functionality of the alignment algorithm, a laboratory benchtest was conducted to evaluate the angular ... day before, and high AOD (;0.5 at 440 nm) just after sunrise on 31 May Lunar data collection started ;4 h after the last available sun data on 30 May and stopped ;1 h prior to the next available ... authors wish to acknowledge Marius Canini (Cimel Eletronique), Nader Abuhassan (UMBC), and Joel Schafer (Sigma Research) for technical advice and assistance, and Patricia Sawamura (UMBC), Daniel Orozco

Ngày tải lên: 26/10/2022, 09:15

... accepted as a valid alignment and raw data for all filter passbands are recorded To verify the functionality of the alignment algorithm, a laboratory benchtest was conducted to evaluate the angular ... day before, and high AOD (;0.5 at 440 nm) just after sunrise on 31 May Lunar data collection started ;4 h after the last available sun data on 30 May and stopped ;1 h prior to the next available ... authors wish to acknowledge Marius Canini (Cimel Eletronique), Nader Abuhassan (UMBC), and Joel Schafer (Sigma Research) for technical advice and assistance, and Patricia Sawamura (UMBC), Daniel Orozco

Ngày tải lên: 26/10/2022, 09:15

... film as affected by plasticizer treatments," Food Science and Technology Research, vol 7, no 3, pp 191-194, 2001 [255] S Yano, H Maeda, M Nakajima, T Hagiwara, and T Sawaguchi, "Preparation and ... E Rohaeti, E Laksono, and A Rakhmawati, "Characterization and the activity of bacterial cellulose prepared from rice waste water by addition with glycerol and chitosan," ARPN J Agric Biol Sci, ... [183] D C Rodrigues, C A Caceres, H L Ribeiro, R F de Abreu, A P Cunha, and H M Azeredo, "Influence of cassava starch and carnauba wax on physical properties of cashew tree gum-based films," Food

Ngày tải lên: 03/05/2023, 09:36

... film as affected by plasticizer treatments," Food Science and Technology Research, vol 7, no 3, pp 191-194, 2001 [255] S Yano, H Maeda, M Nakajima, T Hagiwara, and T Sawaguchi, "Preparation and ... nano-bacterial cellulose," International journal of biological macromolecules, vol 118, pp 722-730, 2018 [224] A Dirpan, I Kamaruddin, A Syarifuddin, A Rahman, R Latief, and K Prahesti, "Characteristics ... [183] D C Rodrigues, C A Caceres, H L Ribeiro, R F de Abreu, A P Cunha, and H M Azeredo, "Influence of cassava starch and carnauba wax on physical properties of cashew tree gum-based films," Food

Ngày tải lên: 05/05/2023, 15:16

... film as affected by plasticizer treatments," Food Science and Technology Research, vol 7, no 3, pp 191-194, 2001 [255] S Yano, H Maeda, M Nakajima, T Hagiwara, and T Sawaguchi, "Preparation and ... E Rohaeti, E Laksono, and A Rakhmawati, "Characterization and the activity of bacterial cellulose prepared from rice waste water by addition with glycerol and chitosan," ARPN J Agric Biol Sci, ... [183] D C Rodrigues, C A Caceres, H L Ribeiro, R F de Abreu, A P Cunha, and H M Azeredo, "Influence of cassava starch and carnauba wax on physical properties of cashew tree gum-based films," Food

Ngày tải lên: 05/05/2023, 15:29

... film as affected by plasticizer treatments," Food Science and Technology Research, vol 7, no 3, pp 191-194, 2001 [255] S Yano, H Maeda, M Nakajima, T Hagiwara, and T Sawaguchi, "Preparation and ... E Rohaeti, E Laksono, and A Rakhmawati, "Characterization and the activity of bacterial cellulose prepared from rice waste water by addition with glycerol and chitosan," ARPN J Agric Biol Sci, ... [183] D C Rodrigues, C A Caceres, H L Ribeiro, R F de Abreu, A P Cunha, and H M Azeredo, "Influence of cassava starch and carnauba wax on physical properties of cashew tree gum-based films," Food

Ngày tải lên: 08/05/2023, 17:39

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... water is the same as the gas phase temperature 2.2.2 Gas diffusion layers The physics of multiple phases through a porous medium is further complicated here with phase change and the sources and ... self-heating on the water balance within passive air-breathing fuel cells Rajani and Kolar [3] developed a single-phase two-dimensional model for a planar air-breathing PEM fuel cell that considered

Ngày tải lên: 05/09/2013, 14:58

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... endo-glucanase, exo-glucanase and β-glucosidase Endo-and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase ... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The

Ngày tải lên: 05/09/2013, 15:28

... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from ... to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... reasons for gathering and analyzing data, as well as the formulation of this data into use cases Use cases will be the foundation for determining data requirements for the system Module 3: Using

Ngày tải lên: 10/12/2013, 17:15

... Generate Dataset dialog box, the following: a Create a New DataSet b Double-click DataSet1 and type TransactionDataSet c To generate the TransactionDataSet typed DataSet, leave the other dialog ... Microsoft ADO.NET architecture The DataSet class plays a central role in the ADO.NET architecture A DataSet is an in-memory cache of data obtained from many possible data sources such as databases ... the Data tab Drag a SqlDataAdapter object from the Data tab to the Design view of the asmx file The Data Adapter Configuration Wizard is displayed Complete the Data Adapter Configuration Wizard

Ngày tải lên: 21/12/2013, 05:17

... are stored in a small wrapper class called Param Each pair holds one pair of the parameters class Param // A class that stores a name-value pair of parameters { private String name, value; Param ... processing program may read and write files on the server and access and modify a database 13 Accessing a Database from a Web Page The database we will initially use is that for an address book The following ... } } // EmailProcessor As you can see, this class only echoes the data on the form It could also save the data to a file or store it in a database If the data contained prices and quantities it

Ngày tải lên: 22/12/2013, 17:15

... OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and create a data table. Then set the ' data source of the data grid. odaDisplay = ... string is passed to a DataAdapter control, filling a data table. From there, the data is displayed when the data source of the DataGrid control is set to the data table. Users can change the ... to your ASP.NET application. When creating database applications, even on the Web, one of your clients inevitably wants to be able to examine the data in his database, and not necessarily in

Ngày tải lên: 26/01/2014, 11:20

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... Ultrasound’s potential as a male contraceptive was first reported by Fahim et al [3] In a series of publications, it was shown that a single application of ultrasound could result in a dramatic ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison

Ngày tải lên: 05/03/2014, 17:20

... ambient air pollutants display significant smallscale spatial variation This intra-urban spatial variation has been documented especially for traffic-related pollutants such as NO , black smoke, ... 13 Foraster M, Deltell A, Basagana X, Medina-Ramon M, Aguilera I, Bouso L, Grau M, Phuleria HC, Rivera M, Slama R, et al: Local determinants of road Van den Hooven et al Environmental Health 2012, ... JR, Bhatnagar A, Diez-Roux AV, Holguin F, Hong Y, Luepker RV, Mittleman MA, et al: Particulate matter air pollution and cardiovascular disease: An update to the scientific statement from the American

Ngày tải lên: 06/03/2014, 19:20

... different measures are shown in Table 7.     Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  ... doing so, the consensus on the problems and  their solutions can be reached. However, it is  noted that MCA is subjective in its nature. In  case  the  quantitative  data? ? are  available,  quantitative  analysis  (i.e.  numerical  ... Multi‐criteria  analysis;  Feasible  measures;  Sustainable  development;  Quang Tri Province.   1. Introduction*  As? ?regards topography, Quang Tri has all  types  of  topography:  mountains,  hills,  plains 

Ngày tải lên: 22/03/2014, 12:20

... surface At a Froude number of 1.0 (Fig 7), the lateral spread of the plume was about the same as that at the stronger stratification (F = 0.4), but the vertical spread was about twice as large, ... were drawn to fit the data as measured, but a generous allowance was made for scatter in order that they might also satisfy our physical intuition The graph suggests that the largest concentrations ... decrease would have been Hi/H:, or a factor of How these results compare with our theoretical ideas of Part I, and the ideas put forward by Egan (1975) and Egan and Bass (1976)? These theoretical

Ngày tải lên: 18/05/2014, 19:36

... TAYTTTAAAARGTGTCMAGTGT Gamma 12 CTYTTAAAAGGKGTCCAGWG Gamma 13 CYTTTAMATGGTATCCAGTGT Gamma 14 ATGGCAGCWGCYCAAAG Gamma 15 CTTTTAAAAGWTGTCCAGKGT Gamma 16 CTTCCTGATGGCAGTGGTT C region gamma primer TAACCCTTGACCAGGCATCC ... kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG Gamma 2 AGGTVMAACTGCAGVAGTCWGG Gamma 3 AGGTVVAGCTGCAGVAGTCWGG Gamma 4 ACTGCAGGTRTCCACTCC ... Signal sequence/framework primers Kappa 1 GGTGATATCGTGATRACMCARGATGAACTCTC Kappa 2 GGTGATATCWTGMTGACCCAAWCTCCACTCTC Kappa 3 GGTGATATCGTKCTCACYCARTCTCCAGCAAT Kappa 4 CTGWTGTTCTGGATTCCTG Kappa 5

Ngày tải lên: 18/06/2014, 22:20