type 1 interferons and the virus host relationship a lesson in détente 879
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
Ngày tải lên :
09/08/2014, 01:24
... doi :10 .11 86 /14 77-7 819 -9-6 Cite this article as: Griniatsos et al.: Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type (MEN1) and a novel mutation in the MEN1 ... sensitivity and specificity of the CA -12 5 Although cardiovascular, lung and chronic liver diseases are the most frequent diagnoses in patients with increased CA -12 5, other intra-abdominal non-malignant ... Spiegel AM, Marx SJ: Multiple endocrine neoplasia type 1: new clinical and basic findings Trends Endocrinol Metabol 20 01, 12 :17 3 -17 8 24 Chandrasekharappa SC, Guru SC, Manickam P, Olufemi SE, Collins...
- 7
- 412
- 0
Báo cáo y học: " Human Immunodeficiency Virus type-1 reverse transcriptase exists as post-translationally modified forms in virions and cells" pdf
Ngày tải lên :
13/08/2014, 05:21
... SH: HIV -1 reverse transcriptase is phosphorylated in vitro and in a cellular system Int J Biochem Cell Biol 19 99, 31: 1443 -14 52 Harada S, Haneda E, Maekawa T, Morikawa Y, Funayama S, Nagata N, Ohtsuki ... the top of the gradient and viral Gag DNA analysed by real time PCR Fractions 7–8, containing HIV DNA and sedimenting at 1. 19 1. 25 g/ml sucrose was immunoprecipitated with AIDS patient sera and ... system The theoretical pI's for RTHXB2 and recombinant RTLAI were the same (Table 1) The theoretical pI of GAPDH, used as an internal standard, was calculated to be 8.52 Additionally, we calculated...
- 12
- 252
- 0
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc
Ngày tải lên :
20/02/2014, 01:20
... of Ca2+ channels, either localized in the membranes of intracellular Ca2+ stores or in the plasma membrane Such Ca2+ entry channels in the plasma membrane and Ca2+ release channels in intracellular ... producing cADPR (such as CD38 and CD157) and transport systems for cADPR in the plasma membrane open the possibility that cADPR acts as a paracrine signalling molecule (reviewed in [14 ]) Indeed, ... subcellular Ca2+ signalling and the induction of global Ca2+ waves, which occurred in an oscillatory manner [47] In terms of structure–activity relationship these data indicate that the northern and...
- 8
- 469
- 0
Internal audit in banks and the supervisor''''s relationship with auditors pptx
Ngày tải lên :
06/03/2014, 19:20
... compliance with sound internal auditing standards, such as the Institute of Internal Auditors’ Standards for the Professional Practice of Internal Auditing In particular, the head of the internal audit ... comprehensiveness) and timeliness of financial and management information; • the continuity and reliability of the electronic information systems; and • the functioning of the staff departments 36 The internal ... This means that internal audit is given an appropriate standing within the bank and carries out its assignments with objectivity and impartiality 18 The internal audit department must be able to...
- 25
- 517
- 0
Internal audit in banks and the supervisor’s relationship with auditors: A survey pdf
Ngày tải lên :
11/03/2014, 02:20
... is also known as International Auditing Practice Statement 10 04 The IAPC has been renamed International Auditing and Assurance Standard Board (IAASB) The Survey The Accounting Task Force of the ... 35 The activities of the internal audit department should include drawing up a riskbased audit plan, examining and assessing the available information, communicating the results, and following ... following: • the examination and evaluation of the adequacy and effectiveness of the internal control systems; • the review of: - the accuracy and reliability of the accounting records and financial...
- 16
- 522
- 0
the relationship between corporate culture and the use of management accounting innovations in vietnamese companies a study of techcombank
Ngày tải lên :
13/03/2014, 14:20
... culture and the management accounting innovation ii Understand what is the relationship between the corporate culture and the innovations of managerial accounting in Techcombank iii Understand why and ... Johnson and Kaplan’s (19 87) Relevance Lost: The Rise and Fall of Management Accounting, “innovations such as activity-based costing/management, the balanced scorecard, value-chain analysis and economic ... competitive advantages of an organization when taking part in the international marketplace 2.2 Overview of the innovation of management accounting 2.2 .1 Definition of management accounting Management accounting...
- 86
- 898
- 0
the relationship between corporate social responsibility implementation and the development of five selected companies in hanoi
Ngày tải lên :
13/03/2014, 14:20
... to Alexander Dahlsrud, there are “37 definitions of CSR were found and analyzed, among them definitions were primarily of European and American origin, but definitions from India and Canada were ... secondary data, and in this research, both primary data and secondary data will be used 3.3 .1 Primary data Primary data consists of information collected for the specific purpose at hand (Amstrong ... for each aspect 28 4 .1 Introduction about Vinalmilk and Tam Viet 4 .1. 1 Introduction about Vinamilk Vinamilk is Vietnamese biggest company in food and beverage industry From establishing in 19 76,...
- 67
- 845
- 0
Báo cáo khoa học: Thioredoxin reductase from the malaria mosquito Anopheles gambiae Comparisons with the orthologous enzymes of Plasmodium falciparum and the human host pdf
Ngày tải lên :
31/03/2014, 07:20
... forward, 5¢-CGCAG GATCCGCGCCATTGAATCAGGAAAACTATGAGT ACGATCTGGTG-3¢ (containing a BamHI restriction site); and reverse, 5¢-TCCTAAGCTTCTAGCTGCAG CAGGTCGCCGGCGTCG-3¢ (containing a HindIII restriction ... buffer) were analysed in parallel Cloning of A gambiae TrxR -1 The A gambiae trxr -1 gene was PCR cloned from genomic DNA as well as from the cDNA of adult insects In the case of the amplification from ... of the spectra was internally performed by a two-point linear fit using the autolysis products of trypsin at m/z 842.50 and m/z 2 211 .10 The peptide masses were screened against the NCBInr database...
- 10
- 430
- 0
Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf
Ngày tải lên :
20/06/2014, 01:20
... GCCCAGGGAAGAAAAAGAATC TLR3 Forward Reverse TAGCAGTCATCCAACAGAATCAT AATCTTCTGAGTTGATTATGGGTAA TLR4 Forward Reverse ACACAGAAGAGCTGGCATGA GGTTGTCGGGGATTTTGTAG TLR9 Forward Reverse CTTCCCTGTAGCTGCTGTCC ... manuscript All authors have read and approved the final manuscript Acknowledgements We thank Camilla Aspelin, Terhi Helander, Marja-Leena Mattila, Outi Rauta and Johanna Vänni for expertise in ... CCTGCACCAGGAGAGACAG IFN-α (1/ 13) Forward Reverse TGGCTGTGAAGAAATACTTCCG TGTTTTCATGTTGGACCAGATG IFN-β Forward Reverse TCTCCACGACAGCTCTTTCCA ACACTGACAATTGCTGCTTCTTTG MyD88 Forward Reverse TGGCACCTGTGTCTGGTCTA...
- 11
- 361
- 0
báo cáo hóa học:"Personality and the physician-patient relationship as predictors of quality of life of cardiac patients after rehabilitation" pptx
Ngày tải lên :
20/06/2014, 16:20
... 66(5):633-9 10 Narita K, Murata T, Takahashi T, Hamada T, Kosaka H, Yoshida H, Wada Y: The association between anger-related personality trait and cardiac autonomic response abnormalities in elderly ... to a significant increase in explained variance for all six HRQOL scales The amount fluctuated between 1. 3% and 2.9% and is thus generally greater than the increase in explanation of variance ... beginning and end of the inpatient rehabilitation lasting an average of 21 (+/-3 .1) days, the patients were asked to fill out a questionnaire that, in addition to sociodemographic information, included...
- 11
- 362
- 0
Báo cáo toán học: "Maximising the permanent of (0,1)-matrices and the number of extensions of Latin rectangles" docx
Ngày tải lên :
07/08/2014, 06:22
... Mass., 19 78 [12 ] H Minc, Theory of permanents 19 78 -19 81, Linear and Multilinear Algebra 12 :227-263, (19 83) [13 ] A Schrijver, Bounds on permanents, and the number of 1- factors and 1- factorizations ... Th A 29:59-73 (19 80) [10 ] D Merriell, The maximum permanent in Λk , Linear and Multilinear Algebra 9: 81- 91 n (19 80) [11 ] H Minc, Permanents, Encyclopedia Math Appl., Addison-Wesley, Reading, Mass., ... 1 1 1 0 0 1 1 0 0 1 1 0 0 1 1 0 1 1 0 1 1 0 0 1 1 0 0 1 1 0 0 1 1 1 1 0 0 0 0 Figure 2: A( R) for maximising R ∈ L(4, 9) There are only two cases where both G(R) and...
- 20
- 256
- 0
Báo cáo khoa học: "Pheochromocytoma associated with neurofibromatosis type 1: concepts and current trends" pdf
Ngày tải lên :
09/08/2014, 03:21
... experience and that of others indicate that early ligation of the adrenal vein is not always feasible because of the posterior entrance to the cava on the right and the medial entrance to the renal vein ... manuscript preparation CAA: data collection and manuscript preparation MKD: data collection and manuscript preparation GIP: data collection and manuscript preparation DKG: data collection and manuscript ... preparation MKP: data collection and manuscript preparation and review All authors read and approved the final version Competing interests The authors declare that they have no competing interests...
- 4
- 380
- 0
Báo cáo y học: "Silencing CD36 gene expression results in the inhibition of latent-TGF-β1 activation and suppression of silica-induced lung fibrosis in the rat" pdf
Ngày tải lên :
12/08/2014, 14:20
... 5'-GAAGCACTGAAGAATCTGAAGAG-3'; antisense: 5'-TCCAACACCAAGTAAGACCATC-3'), and βActin (sense: 5'-CGGCATTGTCACCAACTG-3'; antisense: 5'-CGCTCGGTCAGGATCTTC-3'), were synthesized by Genechem (China) ... experiments, participated in the experimental design and in the interpretation of data, and drafted the manuscript YC conceived of the study, participated in the analysis of data, helped draft the manuscript ... LL participated in the animal instillation and in the histological and immunohistochemical experiments JC initiated the project, participated in the design of the study and in the interpretation...
- 9
- 365
- 0
Báo cáo y học: " Live cell visualization of the interactions between HIV-1 Gag and the cellular RNA-binding protein Staufen1" pot
Ngày tải lên :
12/08/2014, 23:23
... membrane foci The Gag-binding domain in IMP1 was mapped to the four KH RNA-binding domains [35] Therefore we performed BiFC analysis; and as expected, the IMP1-KH (1- 4)-Gag interaction was maintained ... demonstrate that the intermolecular associations between the host mRNA-binding protein Staufen1 and HIV -1 Gag occur in the cytoplasm and at the plasma membrane in HeLa cells and T lymphocytes Furthermore, ... specific Gag- RNA interactions in living mammalian cells Gag-Gag and Gag-Staufen1 interactions as visualized by BiFC were found consistently in the cytoplasm and at plasma membrane lipid raft domains...
- 19
- 216
- 0
Báo cáo y học: " Open Access Quantification of the virus-host interaction in human T lymphotropic virus I infection" pdf
Ngày tải lên :
13/08/2014, 09:21
... proviral load and then extend the boundary of the bin until at least one HAM/TSP and one AC data point were included A boundary was then drawn and the next bin started The maximum number of bins ... estimated using a Monte Carlo approach That is, the AC and HAM/TSP labels were removed from the proviral load-Tax expression data pairs and randomly reassigned The resulting "data" was binned using ... for proviral load per se On the other hand, the association between proviral load and HAM/TSP reported in the Japanese population [1] may not result from a high proviral load increasing the risk...
- 9
- 382
- 0
myers et al - 2003 - exploring the term of the auditor-client relationship and the quality of earnings a case for mandatory auditor rotation
Ngày tải lên :
06/01/2015, 19:43
... industries); and a control based on calendar year income-increasing accruals and/ or inappropriate income-decreasing accruals Incomeincreasing accruals can be used to in ate current earnings, while income-decreasing ... data on the 20 01 Compustat annual industrial and research files to estimate accruals In addition, we require at least the six years of prior data to ensure that any abnormal accruals behavior associated ... management and accruals behavior, and earnings quality and accruals behavior Early studies used the change in Total Accruals as a measure of management discretion (e.g., Healy 19 85; DeAngelo 19 86),...
- 21
- 420
- 0
Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH
Ngày tải lên :
04/10/2015, 16:03
... AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG SMRT -A GeneID 20602 GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA GGGGGGTATCTTAGTTTCGTGGAAGTTCTCTCCACGAAACTAAGATACCCAAAAATTCGA SMRT-B GeneID 20602 GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA ... GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA AGCTTAAAAATGACTACATCACCTCGCAGTCTCTTGAACTGCGAGGTGATGTAGTCAGGG Table 2: Oligonucleotides designed for synthesis of siRNA 2.2.2.2 Annealing ... Target Accession Gene NO Sequence (5’-3’) Forward Sequence (5’-3’) Reverse N-CoR GeneID 2 018 5 GATCCCCAGGAAGAGTGTTCCTGATTTTCAAGAGAAATCAGGAACACTCTTCCTTTTTTA AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG...
- 94
- 284
- 0
Consumer society and the technology of education a case study of the singapore education system 1
Ngày tải lên :
12/10/2015, 17:35
... to learn and demonstrate learning It allows teachers and pupils to: • manipulate images and data; • visualise concepts; • interact with on-screen materials and receive instant feedback Virtual ... Media Awards The Schools Digital Media Awards (SDMA) is a yearly competition that provides a platform to nurture young talents in the area of creative digital media, and to encourage user-created ... promoting teamwork and collaboration, it also aims to enhance the development of media literacy among students and teachers Media -in- Education workshops are also organized to expose teachers and...
- 4
- 396
- 0