treatment of flexion contracture at the pip joint
Improving the performance of international payment at the Vietnam Joint Stock Commercial Bank for Industry and Trade
Ngày tải lên :
31/03/2015, 10:03
... between the organizations and individuals of this nation and ones of the other nation, or between a nation and international organizations, through the relationship between the banks of the nations ... below 2% of the total revenues of the bank These low IP revenues are not commensurate with the reputation, scale and ability of VietinBank This thesis offers appropriate solutions to improve the IP ... from other business activities of the banks Basing on the rate of IP revenue/Total revenue of a commercial bank, we can see the importance of the IP business in that bank b Market share valuation...
- 80
- 1.8K
- 39
Designing an esp syllabus for the second-year students of library study at the national teachers training college
Ngày tải lên :
07/11/2012, 14:36
... consideration of the students needs and the objectives of the course, together with the institutional bias of the teaching institution It implies that a material designer must analyze the needs of the ... the administrators) 3.3.3.4.2 The organization of the syllabus Basing on the results of the surveys and the official requirements of the college, we have offered an ESP reading syllabus for the ... Furthermore, students at University of Cultures are of higher level of English proficiency than that of the students at NTTC And the target students at NTTC are lower in comparison with that at...
- 76
- 737
- 4
An english-vietnamese cross-cultural study of keeping face at the first encounter
Ngày tải lên :
07/11/2012, 14:54
... communication at the first encounter 25 Situation a To business partner of higher status in the office b To their business partner of equal status in the office C To their business partner of lower status ... requested to provide information about: Their nationality Their age Their sex Their marital status Their occupation Their residence Their acquisition of foreign language The informants are assured ... between the speakers communicative intention, the interlocutors expectation of the message and the communicative effects of the message Problems in communication, especially cross-cultural communication...
- 51
- 1.3K
- 12
Shaking a box of sand II – at the jamming limit, when shape matters
Ngày tải lên :
01/11/2013, 08:20
... p(C) is the probability that the system is in the orientation configuration C in the steady state, and the sum runs over all the 2n configurations of a system of n grains This can be estimated theoretically ... be the most visited; and, on the other, the flatness hypothesis of Edwards, which states that for large enough systems, the macroscopic entropic landscape of visited configurations is at [15] The ... of the configurations of a column of 12 grains in the zero-temperature steady state with = 1, against the configurations C in lexicographical order The empty circles mark the 26 = 64 ground-state...
- 11
- 392
- 0
Tài liệu Treatment of trade finance under the Basel capital framework ppt
Ngày tải lên :
17/02/2014, 21:20
... result of this evaluation, the Committee has adopted two changes to the treatment of trade finance in the Basel II and III capital adequacy framework These changes respect the integrity of the capital ... countries While data is scarce on the relative importance of the different types of trade credit, rough estimates based on ICC data show that letters of credit represent approximately 20% of all trade ... therefore, to base the calculation on the effective maturity for transactions with a maturity of less than one year It believes that this should become the rule rather than an item left to national...
- 10
- 474
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
Ngày tải lên :
20/02/2014, 23:20
... using the SIGMA PLOT software Temperature-dependence of catalytic activity The dependence of the catalytic activity of E1 on temperature was investigated using the DCPIP assay over a temperature ... 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to be 5–10 °C below that of wild-type ... detected by the PDH assay The interaction of E1 (a2b2) with the PSBD was unaffected by any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH...
- 10
- 459
- 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
Ngày tải lên :
07/03/2014, 11:20
... different polyunsaturated primary alcohols with the hydroxyl group in Ca, representative of the range of AAO substrates [9,19,33] Most of these alcohols docked in front of the re-side of the isoalloxazine ... docking calculation, and in all cases more than 50% of them clustered together in front of the rectus (re)-face of the isoalloxazine ring of the FAD cofactor This substrate location is shown ... glycoprotein of 70 kDa with dissociable flavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols to their corresponding...
- 11
- 471
- 0
An Investigation into the Implementation of a Brewpub at the New Student Union Building docx
Ngày tải lên :
08/03/2014, 23:20
... Assessment of the brewpub’s economic feasibility falls into two categories: assessment of the brewpub’s operating cost and projection of the brewpub’s likely operating revenue In the assessment of the ... Biofuel initiative The brewpub could use biofuel to fuel the stoves heating the mash in the brewing process Biofuels, in addition to being sustainable, also produces CO2 offset of up to 85% The ... transport the waste water to the Iona Island Sewage Treatment facility via the Greater Vancouver Regional District (GVRD) sewer (Grant and Hill, 2002) The wastewater at the facility center is treated...
- 23
- 481
- 0
Methods of Policy Accommodation at the Interest-Rate Lower Bound ppt
Ngày tải lên :
15/03/2014, 14:20
... following the return of the natural rate of interest to its normal level has a dramatic effect on the severity of both the economic contraction and the deflation that occur during the period of the negative ... on the days that these two statements were released In each case, there is a clear, immediate effect on expectations of the future path of the funds rate: OIS rates fall, despite the fact that the ... discussion of the forward path of interest rates with an explanation of the considerations behind it — in particular, of the policy commitments that the anticipated forward path reflects Discussion of the...
- 97
- 494
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
Ngày tải lên :
17/03/2014, 17:20
... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... 60 Da The molecular mass of the transferase increased by 750 Da when the enzyme was incubated in the presence of 100 lM propionyl-CoA prior to the measurements, indicating the formation of an ... search, this part of the sequence showed similarity to the smaller subunits of the latter enzymes The catalytic glutamate residue of hetero-oligomeric enzymes belonging to the 3-oxoadipate CoA-transferase...
- 9
- 498
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
Ngày tải lên :
23/03/2014, 09:20
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... features The interaction of Bro1 with Vps4p is regulated by ATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATP binding nor ATP hydrolysis Our data ... presence of ATP (Fig 2) To determine whether the decreased binding in the presence of ATP is due to ATP hydrolysis or ATP binding, the effect of ATP on binding to a Vps4p mutant (Vps4p–E233Q) that...
- 14
- 362
- 0
Báo cáo khoa học: Hepatocyte-specific interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc
Ngày tải lên :
23/03/2014, 10:20
... stabilization of GR binding to the GRU, and thereby stabilization of the interaction of the coregulators interacting with the nucleoprotein complex formed at the GRU This raises the possibility that ... regulation results from the cooperative binding of transcription factors [12] One of the key determinants of the activation of genes that are under the control of hormone response units is the ... established at the GRUs prior to glucocorticoid activation [4,19] Even though the assembly of the transcription factor complex at the CPS GRU seems to be similar to that of the distal TAT GRU at ) 5.5...
- 9
- 429
- 0
Taxation of European Companies at the Time of Establishment and Restructuring docx
Ngày tải lên :
23/03/2014, 11:20
... states which had not transposed the directive in time.53 When looking at the ratio of SEs and the population of the member states,54 the rather small member state Luxembourg is leading Here the ... .XIX List of Tables .XXI Introduction 1.1 Motivation of the thesis 1.2 Aim of the thesis and object of examination 1.3 Organization of the thesis ... state to another member state and the exit out of an SE With regard to the entry, the four options to establish an SE are assessed: the merger, the foundation of a holding, the foundation of...
- 282
- 569
- 0
Paper based on transcript of speech presented at the Global Economic Prospects meeting, Peterson Institute for International Economics doc
Ngày tải lên :
29/03/2014, 03:21
... discount rate further and faster • They could persuade the US Congress to enact the second fiscal stimulus package They could expand further the scale, the duration, the collateral, and list of counterparties ... reduce the average profit rate But they would also reduce the risk of financial crises and what you and I pay for them Reform Reduce conflict of interest at credit rating agencies by separating the ... just tweaked at the margin Two of the key features of Basel II are that banks can use their own internal models to calculate capital requirements under Pillar 1, and that credit ratings also serve...
- 8
- 309
- 0
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
Ngày tải lên :
29/03/2014, 14:20
... externalities at the national level The essential idea behind the EVA system is that state -of- the- art methods are used in all the individual parts of the impact-pathway chain Other comparable ... than the oscillations using the tagging method Consequently, estimates of the δ-concentrations are much more accurate page 14 of 98 Figure 3: An overview of the tagging method The concentration ... The external cost of a specific emitted compound is highly dependent on the location of the emissions in relation to the spatial distribution of the population around the source of interest as well...
- 98
- 634
- 0
the ethics of killing problems at the margins of life jan 2002
Ngày tải lên :
11/06/2014, 02:12
... That form is the human soul This is the hylomorphic conception of the soul—from the Greek roots hyle (body) and morphe (form) The idea ¯ ¯ that the soul is the form of the body is often elucidated ... hylomorphism, the soul is just the inherent organization of the matter of the body in a distinctive way, so that the matter constitutes an individual of a particular sort What sort of individual ... to date the beginning of the soul’s existence in association with the fetal organism from the time that there is independent evidence of the presence of consciousness If one accepts that the...
- 560
- 573
- 0
Báo cáo hóa học: " Low temperature of radiofrequency ablation at the target sites can facilitate rapid progression of residual hepatic VX2 carcinoma" pdf
Ngày tải lên :
18/06/2014, 16:20
... of the lung B Fractionated view of the lung, which has been magnified to show the details of the metastatic nodules group (Fig 7) The lower the target temperature of RFA was, the higher was the ... larger than that in the control group (12.63 ± 1.87 cm ) It seemed that the lower the temperature of RFA was, the larger the tumor volume was (Fig 3) Effects of low temperature of RFA at the target ... the same liver at the time of animal killing Expression of HGF and IL-6 in the tumor tissues of group I increased dramatically in comparison with that in the control group At the same time, the...
- 10
- 376
- 0
báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf
Ngày tải lên :
20/06/2014, 07:20
... fixator application The main disadvantages to this technique related to the size of the bulky apparatus and the prolonged immobilization of the wrist joint Postoperative wrist immobilization, however, ... achieved in patients with vascularized bone grafts (82-92 points) [18] The patients tolerated the apparatus well, and though rather bulky found that they had good use of the operated hand with the frame ... four patients had received no initial treatment, due to late presentations The mean duration of SNU at Ilizarov frame application (index procedure) was 13.9 months (range 7-36 months) The location...
- 10
- 378
- 0
Báo cáo hóa học: " Chemical characterization of extra layers at the interfaces in MOCVD InGaP/GaAs junctions by electron beam methods" ppt
Ngày tải lên :
21/06/2014, 05:20
... As) 1.02 1.09 1.12 The alloy whose R matches the experimental ratio Rexp is the one that a sublayer is made of The experimental ratios Rexp of the HAADF intensity of sublayer of the nominal GaAs ... scatter incoherently, and the image intensity is the sum of the individual atomic scattering contributions [19] The higher the atomic number Z, the larger the scattering angle is The HAADF intensity ... intensity of sublayers and to the intensity of all the inner standards are then compared to the calculated values of similar ratios for all the alloys that can be formed by combining together all the...
- 7
- 387
- 0