Ngày tải lên: 23/04/2014, 15:51
Cook Like a Pro
... TARTLET PANS Small metal pans are used to make individual tarts, cakes, and other sweet and savory baked goods. Like tart pans, these are available with both stationary and removable bottoms and ... Bradley, Sharon Silva and Sharron Wood; Proofreader Leslie Evans; Indexer Ken DellaPenta; Consultants Healther Belt and Brittany Williams; and Marisa Halvorson and her staff at the Williams-Sonoma ... heat conduction and unevenly baked foods. By contrast, good-quality bakeware that is cared for properly can last a lifetime. BAKEWARE a RIMMED BAKING SHEETS Made of aluminum or aluminum-coated...
Ngày tải lên: 15/01/2014, 12:17
... avoid dark lip liners with paler lipsticks. About the Author Allison Saunders, self-taught professional make-up artist, founder of Hollywood Makeup Secrets, and creator of the Hollywood Makeup ... Applying makeup usually ends with the lips and there are a few things you'll want to remember. Try not to to choose a shade that's too dark for your mouth. If the effect is dramatic, that's ... Secrets Video Beauty System, teaches women how to transform the way they look and feel, quickly and easily, and ultimately feel good about themselves, every single day. This article has been brought...
Ngày tải lên: 16/01/2014, 22:20
Create Your Own Blog: 6 Easy Projects to Start Blogging Like a Pro pptx
Ngày tải lên: 28/06/2014, 17:20
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... acid at a particular position for this family of plant cysteine pro- teases. The primers used were 5¢-TTGCCTGAGCA TGTT GATTGGAGAGCGA AAG-3 ¢ (forward) and 5¢-GGGAT AATAAGGTAATCTAGTGATTCCAC-3¢ ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr D 55,...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... Gln15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... not reveal the classical cold adap- ted features [19], but still initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced. ... Perrakis A, Harkiolaki M, Wilson KS & Lamzin VS (2001) ARP ⁄ wARP and molecular replacement. Acta Crystallogr Sect D Biol Crystallogr 57, 1445–1450. 40 Jones TA, Zou JY, Cowan SW & Kjeldgaard...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... mother liquor as cryoprotectant on a Rigaku Micromax 007 rotating anode generator (Rigaku- MSC, TX ⁄ USA) operating at 40 kV and 20 mA equipped with a Mar-345 image plate detector (MarReasearch, Epp- endorf, ... glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59, 1357–1365. 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser R & Van ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblatt HM, Braun S &...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc
... 5¢-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and 5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3¢, cloned into the expression vector pBAD-TOPO, transformed into the E.coliTop10 strain and grown on LB agar ... They also had comparable Michaelis– Menten kinetic parameters when their amidase activity against succinyl-AAPF-NH-Np was measured at 25 °C (Table 3). DISCUSSION The extracellular proteinase K -like ... of the proteinase gene primers were designed from the sequence of Vibrio alginolyticus [42]: 5¢-GCG GAATTCTACACCCGCTACATGTGGCGTCG CCAT-3¢ and 5¢-CGC GGATCCTGGGGACTAGATC GAATC-GACCAACGTAA-3¢. Underlined...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx
... Tm-mas. A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of 1 : 1000. Phage DNA was isolated from phage lysates by using a lambda DNA preparation ... mosquito Anopheles gambiae to bacteria and malaria parasites. Proc. Natl Acad. Sci. USA 94, 11508–11513. 24. Muta,T.,Hashimoto,R.,Miyata,T.,Nishimura,H.,Toh,Y.& Iwanaga, S. (1990) Proclotting ... 440–443. 30. Jiang,H.,Wang,Y.&Kanost,M.R.(1998 )Pro- phenoloxidase activating proteinase from an insect, Manduca sexta: a bacteria- inducible protein similar to Drosophila easter. Proc. Natl Acad. Sci....
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
Ngày tải lên: 07/03/2014, 00:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
Ngày tải lên: 24/03/2014, 03:21
UK design as a global industry: International trade and intellectual property docx
Ngày tải lên: 31/03/2014, 10:20
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... necessary NACA 4 Development of vital (life threatening) danger possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian ... Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund. We want ... erik.zakariassen@isf.uib.no 1 National Centre for Emergency Primary Health Care, Uni Health, Bergen, Norway, Kalfarveien 31, 5018 Bergen, Norway Zakariassen et al. Scandinavian Journal of Trauma,...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... (MedCalc Software, Mariakerke, Bel- gium). statistical software was used for all statistical anal- yses. Categorical data are presented as absolute and relative frequencies, continuous variables as ... defined according to the usual cri- teria [25]. Acute coronary syndrome, unstable angina and myocardial infarction were defined according to the ACC/AHA criteria [26,27] Statistical analyses MedCalc™ ... Diabet Med 2006, 23:1370-1376. 34. Ishihara M, Inoue I, Kawagoe T, Shimatani Y, Kurisu S, Hata T, Nakama Y, Kijima Y, Kagawa E: Is admission hyperglycaemia in non-diabetic patients with acute...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... the results and drafted the article. MS was involved in critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation ... Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition. London; 2003. 17. National Coordinating Council for Medication Error: Taxonomy ... period was curtailed due to investigator illness. The ICU medical and nurs- ing staff were unaware that the study was being conducted. Ethical approval was not sought, because at the time audits were...
Ngày tải lên: 25/10/2012, 10:39
Bạn có muốn tìm thêm với từ khóa: