... 1998. Machine trans-lation with a stochastic grammatical channel. InProceedings of ACL’98, pages 1408–1414, Mon-treal, Canada.Kenji Yamada and Kevin Knight. 2001. A syntax-based statistical translation ... Global Age. John Benjamins Publishers.Tony Veale and Andy Way. 1997. Gaijin: A template-based bootstrapping approachto example-based machine translation. In Proceedings of “NewMethods in Natural ... translation model anda de-scription of its parameters.3 Building a statistical translation memory Companies that specialize in producing high-quality human translations of documentation and news...
... Nga – K 1 1A 30Graduation paperDeclarationTitle: A new approachto semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... only to practical language but also totranslation theory, the description of particular language, language typology and the study of language universals. In relation to bilingualism, C .A is ... subject at most language universals.According to C. James (1980;19), C .A is a form of inter-language study and a central concern of applied linguistic. As a matter of fact, C .A has had much to...
... It called forstronger legislation against all forms of domestic violence, including marital rape and sexualabuse, and against violence towards women and girls as a human rights violation; and ... human sexuality” and mandates that sexualhealth care should be “the enhancement of life and personal relationships and not merely thecounselling and care related to procreation or sexually transmitted ... where paternal leave is legalized and c o n s i d e red normal, household chores are shared by all, and men are publicly encouraged to careas fathers and husbands.GENDER-BASED VIOLENCE AND MENViolence...
... exposure to pol-lution or access to clean water and clean air varyamong social and economic groups, as discussedlater.lakes and estuaries to eutrophy can be combinedbased on their chemical behavior, ... environmental impacts onhuman health and welfare are key to sustainabil-ity—either as environmental indicators or as com-ponents of social indicators. Equally important aremeasures of the degree to ... substances.Indicator: Global atmospheric concentrations ofCFC-U and CFC-12.Indicator: Stratospheric ozone levels over Canada.Further indicators may be introduced at a laterdate to measure...
... were prepared in a laboratory sheet mould according to standard SCAN-C 26:76. Deionized water was used in the mould and NaHCO3 was added to maintain a constant salinity of 0.5 mM. Handsheets ... paper as a material. In this thesis of basic research, an approach derived primarily from adsorption, adhesion, and polymer sciences was applied to study the fibre bonding and paper strength, and ... considered as the best approachto study the moisture plasticization and viscoelasticity in composite materials made of MFC and different polysaccharides (Paper IV). DMA measurements. Dynamic mechanical...
... compositerestorations-laboratory processed inlays/onlays and veneers3.Indirect ceramic restorations and alloys that are to be resin-bonded- inlays/onlays4.Amalgam restorations-if isolation can ... Books.BIBLIOGRAPHYAdams A: Artificial-light photography, Hastings-on-Hudson,1968, Morgan and Morgan.Agoston GA: Color theory and its application in art and design,New York, 1979, Springer-Verlag.Appleby ... periodontics, and oral and maxillofacial surgery. Alsoincluded are emerging fields such as implantology, implantsurgery, and laser surgery as well as other clinically rele-vant topics such as dental...
... into potential errors (bias and random error) related to data based on clinical examina-Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36Page 8 of 10(page ... of variation and bias inrelation to monitoring of animal disease incidence onherd and national level, causal analysis on national level,as well as estimation of validated treatment criteria.Monitoring ... metritis' that relate to the quality of thedata that are produced. We analyse and build &apos ;a model ofunderstanding' based on DBL's observations and the indi-vidual veterinarians'...
... the team. The database analysts and theprogrammers are unable to agree on the proper ways to pass informationback and forth between the interface and the database, and the require-ments analysts ... packages),• hardware and software implementation (implementing new computers orsoftware),• database management and revision (ensuring proper data storage and access),• hardware and software upgrades ... groupware, specializedsystems such as accounting packages, and Internet and World Wide Websites and applications. While the field of IT is as broad and diverse as theorganizations and individuals...
... than before,again including the occipital, temporal, and the frontal lobes, butinparticularbilateral orbital frontal corlex.Whatdothe resultsofKawabata and Zeki (2004) and Skovefal. ... neuralcorrelatesofpreference and beauty, two variables that have affective and cognitive components. The areas activated by Vartanian and Goel (2004b) mayhave highlighted thosecOrlicalstructures ... 2003,p.56).Infact, the model seems to include a decision phase only as an approach to laboratory settings, where participants are usually asked to state theirpreferences or make decisions about a certain...
... components that are key to success ● HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes EffectsAnalysis are quantitative technical failure analysis techniques ● SWOT and PESTLE ... this may need to be developedinto a set of targets for health and safetyperformance. There is a danger that risk appetitestatements fail to be dynamic, and they canconstrain behaviour and rapid ... assurance available to theBoard and the audit committee. An evaluation ofthe level of assurance that has been obtained isalso necessary. Often, a major source of riskassurance for the Board...
... Geneva, Switzerland. August 2006. Water Conservation 5 18 A Practical Approachto Water Conservation Reason 3 Minimising value chain related risk Today corporate reputation is a more important ... the capital and operating costs as well as the associated financial costs and dividends to share-holders. Only recently have governments started using the pricing mechanism as a demand management ... 2.3.3.2 Hardness, Calcium and Magnesium Calcium Ca2+ and magnesium Mg2+ give water its hardness. Hard water is difficult to lather and therefore hardness is a measure of Ca2+ and Mg2+...
... CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella ... study.Oligonucleotide name Sequence (5¢ -to3 ¢)OMCA-KO-F CACACTGCAACCTCTGGTOMCA-KO-R ACTGTCAATAGTGAAGGTOMCB-KO-F CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the left and right of the agarose gels. (B) Visualization and separation ofhigh molecular mass...
... code:1.1. Playing with Memory 111.1.4 How to Crash Your ProgramThere is no faster way to crash a program than to make a mistake with memory. (Actually, this statement overstates the case: a program ... intended. But initializing variables at least avoids theintroduction of truly garbage data, data that can be any arbitrary value.Here is a far more dangerous use of uninitialized variables:1 {2 ... Engineers A Foundational Approachto LearningC and Matlab24 Chapter 1. Memory: The Stack5 int main() {6 int a = 0;7 incr(& ;a) ;8 incr(& ;a) ;9 return 0;10 }Although incr lacks an explicit...