this is a place of famous in vietnam it has 9 words

... leukemia/lymphoma 10 Baculoviral IAP repeat-containing Bcl2-like 14 (apoptosis facilitator) BH3 interacting domain death agonist BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing ... repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC22 domain family Cell-death inducing DNA fragmentation factor CASP2 and RIPK1 adaptor domain containing protein Fas-associated ... superfamily member 1 2a Activating transcription factor B-cell leukemia/lymphoma 10 BH3 interacting domain death agonist Defender against cell death MAP kinase interacting protein Ring finger protein...

Ngày tải lên: 19/06/2014, 22:20

... into various regulatory— regulations I mean, I— as a life in we have a life insurance company It tells us— what we can in terms of BBB or in terms of A and all of that sort of thing So state after ... after state has regulations relating to insurance companies that ties in with the rating agencies And the agencies are specified And so I can't go to the XYZ rating agency and say, "Will you this ... was really moving along at quite a clip BUFFETT: The economy's picking up steam And particular March, April, and May, it' s— it' s— it' s shown some acceleration So what's happening in Europe has...

Ngày tải lên: 28/06/2014, 17:20

... variables measured at day 1, day 6, and the change in value between day and Stata 9. 0 (StataCorp, College Station, Texas) computer software was used for statistical analysis All interval data ... PaO2 [11] For patients with trauma-induced ALI, the Injury Severity Score [12] was determined Statistical Analysis The primary outcome variable of this study was death prior to hospital discharge ... published [4] This study was conducted at the University of California Moffitt-Long Hospital, a tertiary university referral center, and at San Francisco General Hospital, a large, inner-city...

Ngày tải lên: 12/08/2014, 13:22

... (Sumit, 2010) Because of the important role played by monitoring, COSO originally includes ongoing monitoring in its first Integrated Framework released in 199 2 Ongoing monitoring is again emphasized ... year Those in managerial functions were aware of the risks of their areas of responsibility and knew how risk management was implemented In my opinion the company’s risk analysis and means of ... step of the sampling process is the ability to collect samples The author of this study has been working in auditing companies more than six years and has long relationship with external auditors...

Ngày tải lên: 10/01/2018, 14:59

... is amalgamating into the global economy, thus Vietnam has to use U.S dollar in trade and invest activities Additionally, the habit of use of U.S dollar in daily activities and trading activities ... Framework ( 198 9), Par 104 (a) Accounting dollarization is similar to Constant Purchasing Power Accounting as defined in IAS 29 Constant Purchasing Power Accounting requires financial capital maintenance ... high such as the inflation rate of Vietnam in 198 9 was 34.6%, in 199 0 25 and 199 1 was very high 67.5% and 67.6% and this rate was 17.6% in 199 2 Vietnam currency depreciated sharply against the...

Ngày tải lên: 13/03/2014, 14:20

... packing materials) In the area of making quality assurance of staff's living standard, a web search “Google" which treats their staff as golden is a best example More than that is many corporations ... data One of the advantages of primary dada collection method is to provide the appropriate information that match with the requirements of this project Primary data has many advantages It is ... organizations to operate in Vietnam that CSR is familiar with them Their awareness can be consider is full but some multinational companies operating in Vietnam took advantages of unknown of Vietnamese...

Ngày tải lên: 13/03/2014, 14:19

... interaction domain of kinase-associated protein phosphatase, a phosphoprotein-binding domain Proc Natl Acad Sci USA 96 , 7821–7826 32 Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK & Singh ... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD buffer, 10 lL of mgỈmL)1 BSA, lL of...

Ngày tải lên: 16/03/2014, 14:20

... industrialization and modernization in Vietnam generally and Southern Vietnam areas particularly In fact, the activities taking place in campus bring about the consumption of energy, materials and chemicals ... achieving campus sustainability has been applied Universities can nowadays be regarded as ‗small cities‘ due to their large size, population, and the various complex activities taking place in ... organizational alignment with sustainability and assesses leading edge practices The study recommends altering Housing‘s current mission statements as well as creating a freestanding sustainability...

Ngày tải lên: 22/03/2014, 09:20

... immunohistochemistry in brains of rats injected intrastriatally with KA Two days after unilateral injection of KA, BNIP3-immunopositive neurons were present in striatal areas adjacent to the site of ... that the increased expression of BNIP3 after KA BNIP3 in excitotoxicity administration was caused by activation of kainate receptors, brain tissue was processed from rats that received intrastriatal ... rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and was absent in samples from Tris ⁄ HCl-injected rats To demonstrate the specificity of...

Ngày tải lên: 22/03/2014, 17:20

... TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.1 TREND DATABASE » PREMIUM GATEWAY M SA E PL w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com ... related real-world examples within the Trend Database Filter trend examples by industry w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.4 TREND DATABASE...

Ngày tải lên: 23/03/2014, 12:20

... expectations (Tahar, 2008) § Parasuraman et al., ( 198 5) defined service quality as a form of attitude that is related to customers‟ expectations and perceptions § According to Lassar, Manolis and ... (2001) in particular suggested that the perceived service quality of students is an antecedent to student satisfaction Hoffman and Bateson ( 199 7) defined SERVQUAL as an attitude that is established ... by Kanji, Abdul Malek and Wallace ( 199 9) give some insights on the real situation of the Higher Education Institutions in Malaysia Most institutions give a great deal of importance to meeting...

Ngày tải lên: 18/04/2014, 16:25

... collection of data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis ... Khan University Hospital, Karachi-74800, Pakistan 3Assistant Professor Department of Surgery (Orthopedics) Aga Khan University Hospital, Karachi-74800, Pakistan Professor Department of Surgery ... India 2007 32 Sons Fa: Number of total knee implants supplied to Pakitan Karachi; 2007 33 Aga Khan University Hospital Karachi, Pakistan Price list [http://www aku.edu/AKUH/Patient_Visitor/page6.shtml]...

Ngày tải lên: 20/06/2014, 04:20

... collection of data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis ... Khan University Hospital, Karachi-74800, Pakistan 3Assistant Professor Department of Surgery (Orthopedics) Aga Khan University Hospital, Karachi-74800, Pakistan Professor Department of Surgery ... India 2007 32 Sons Fa: Number of total knee implants supplied to Pakitan Karachi; 2007 33 Aga Khan University Hospital Karachi, Pakistan Price list [http://www aku.edu/AKUH/Patient_Visitor/page6.shtml]...

Ngày tải lên: 20/06/2014, 07:20

... rid of this defect Day after day, he went to the sea, shouting and roaring with deafening sounds of waves and in the end he acquired a convincing and sonorous voice as he had wished The above saying ... previous failures, we changed tactics and strategies and finally we will succeed Our success is due to our unflinching determination after bitter failures Demosthenes, the greatest Athenian orator, ... before reaching the acme of his glory, had to suffer so much despair and failure The audience did not pay much attention to his political speeches because of his weak voice He resolved that he would...

Ngày tải lên: 22/07/2014, 04:20

... biological facts, which are almost always beyond the reach of most people's intuition, seem to indicate that an even more complex system operates in mammals (or at least mice, from which it is probably ... complex a system as a developing embryo, then facts - and indeed understanding - at many levels must be fed into the mathematics Nor should the value of facts and understanding on their own be dismissed ... monumental achievement So ostensibly significant a difference between vertebrates in so fundamental a process seems surprising, and may dwindle (either in extent or in significance) with the accumulation...

Ngày tải lên: 06/08/2014, 19:20

Ngày tải lên: 07/08/2014, 03:22

... deposited the group's posters, leaflets, and name cards in 26 health facilities at all levels in Hanoi At each facility, IEC materials were posted in waiting places, testing sites, and examination ... number of studies have demonstrated that lack of training and lack of time are the main factors affecting the quality of counselling Also, the negative attitudes of health staff towards HIV infected ... guidelines available, including counselling guidelines appropriate to highand low-workload facilities and including culturally appropriate infant feeding advice A positive atmosphere in the ANC facilities...

Ngày tải lên: 10/08/2014, 05:21

... Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' Site : Fli1 3’ UTR pos 490 - 497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUGCCC-AACUGGAA ... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...

Ngày tải lên: 11/08/2014, 12:20