the system does not detect the vehicle ahead at all
Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx
Ngày tải lên :
07/08/2014, 18:20
... initial denaturing step at 95oC for 10 min; then 35 cycles at 95oC for (denaturing), at 55oC for (annearing), and at 72oC for 1.5 (extension); and a further extention at 72oC for 10 The PCR products ... distilled water for 1.5-2 at 4-6oC The number of homogenization-resistant spermatids was enumerated using a hemocytometer Analysis of sperm kinematics The working medium for mouse sperm kinematics ... calculated with above Reproductive toxicity of genistein in adult mice 229 parameters These parameters have been modeled and refined mathematically to describe the motion of each spermatozoon...
- 8
- 343
- 0
The theory of financial intermediation: An essay on what it does (not) explain
Ngày tải lên :
24/10/2012, 09:11
... studies But the study of all these theories leaves the practitioner with the impression that they not provide a satisfactory answer to the basic question; which forces really drive the financial ... imperfection The mainstream theory of the firm evolved under the paradigm of the agency theory and the transaction costs theory as a theory of economic organization rather than as a theory of entrepreneurship ... expectations and act rationally In so far as this does not occur naturally, intermediaries are useful to bring savers and investors together and to create instruments that meet their needs They...
- 59
- 1.7K
- 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc
Ngày tải lên :
19/02/2014, 07:20
... + mice, the pattern is virtually identical with the exception of the lack of the PV spot in PV– ⁄ – mice (Fig 2A–C) This indicates that expression of fiber type specific MLC isoforms is not affected ... differentially affect Ca2+ signaling pathways, the best characterized in muscle being the CaN and the calmodulin-dependent kinase II (CaMKII) pathways Quantitative RT-PCR revealed that the CaN ... phosphate, respectively; P < 0.01; n ¼ mice per genotype) An up-regulation of that order is found for both COX isoforms, as well as for cytochrome c On the other hand, the up-regulation of F1-ATPase...
- 13
- 578
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
Ngày tải lên :
07/03/2014, 16:20
... ribosome associated SufI (Fig 3) What is the role of TF in Tat-mediated export? Does it prevent the cotranslational engagement of Tat-dependent proteins in other targeting/translocation pathways? We ... The latter observation is not unexpected because TF only associates with Tat substrates during synthesis prior to their folding in an exportcompetent conformation [22] Does TF prevent a premature ... follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical role in the export of Tat-dependent...
- 9
- 393
- 0
Báo cáo khoa học: Reducing expression of NAD+ synthesizing enzyme NMNAT1 does not affect the rate of Wallerian degeneration ppt
Ngày tải lên :
22/03/2014, 16:20
... with the result in vivo, dowregulation of NMNAT1 expression does not affect the rate of axon degeneration in vitro Discussion These data indicate that complete NMNAT1 gene inactivation is incompatible ... Quantification of axon degeneration at the indicated time points after sciatic nerve lesions Note that at 36 h post-lesion, when Wallerian degeneration normally begins, the number of degenerated ... the normal development of the embryo and NMNAT2 and cannot compensate for its loss Decreased NMNAT1 activity in heterozygous null mice, however, does not affect the rate of Wallerian degeneration,...
- 14
- 401
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... mainly on the relative activities of the acetylating and deacetylating enzymes rather than on microtubule dynamics Tyrosination ⁄ detyrosination at the COOH-terminus of a-tubulin is another post-translational ... preferentially on these structures [35] Stabilization of microtubules by treating CAD cells with 10 lm Taxol did not cause increase of acetylated tubulin (Fig 1E), indicating that the acetylation state ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517...
- 14
- 416
- 0
Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf
Ngày tải lên :
23/03/2014, 06:20
... AFFX-ThrX-M _at 1431916 _at – NM_001012306 – Hsd3b3 1417828 _at 1448595_a _at 1428083 _at Aqp8 Bex1 2310043N10Rik 1448568_a _at 1420549 _at 1453109 _at 1416193 _at 1415822 _at 1445862 _at 1424683 _at 1429104 _at 1449067 _at ... NM_007811 Atp9a BC031353 Cyp26a1 1450884 _at 1420879_a _at NM_007643 NM_018753 Cd36 Ywhab 1429831 _at 1418710 _at 1448978 _at 1446731 _at 1417025 _at 1422975 _at AFFX-r2-Bsthr-M_s _at 1417629 _at 1417017 _at NM_031376 ... conceivable in these mice The evaluation of C14SR and LBR expression and the determination of their enzymatic activity in the liver of wild-type and Tm7sf2() ⁄ )) mice reinforce the hypothesis that LBR...
- 14
- 299
- 0
Báo cáo khoa học: The complex of the insect LDL receptor homolog, lipophorin receptor, LpR, and its lipoprotein ligand does not dissociate under endosomal conditions pot
Ngày tải lên :
23/03/2014, 07:20
... was located at the same position as after washing at pH 7.4, indicating that the different pH values of the buffers used in the incubations did not affect the size or the morphology of the cells, ... population 2) The second population is located at the same position as the negative control cells (Fig 1B), indicating that FEBS Journal 275 (2008) 1751–1766 ª 2008 The Authors Journal compilation ... to the receptor (Fig 4E) This indicates that the low Ca2+ concentration in the early endosome is not able to induce dissociation of the LpR–HDLp complex To determine whether the stability of the...
- 16
- 354
- 0
This factsheet is not exhaustive and does not bind the Court pot
Ngày tải lên :
28/03/2014, 16:20
... without their knowledge or consent, which was not required They complain that the operations damaged their physical integrity, their right to found a family and that they suffered discrimination ... donor insemination Although the question of access to PID raised delicate issues of a moral and ethical nature, the legislative choices made by Parliament in the matter did not elude the Court’s ... burdens” resulting from the child’s disability The compensation they were awarded did not therefore cover those “special burdens” The Court found that the law in question was in violation of Article...
- 5
- 340
- 0
Information Management Resource Kit Module on Management of Electronic DocumentsUNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 6. TEXTUAL DATABASES AND CDS/ISIS BASICSNOTE Please note that this PDF version does not have the interactive features offered th doc
Ngày tải lên :
31/03/2014, 20:20
... CDS/ISIS depending on the required features They can personalize the system in order to match your organization’s needs But not all the adaptations can be made, and not all involve the same amount ... either goats or sheep occur, or both Addition NOT ^ Exclusion a query goats ^ sheep retrieves all records where goats occurs, unless sheep occurs in the same record Note: Be careful with the NOT ... match your needs CDS/ISIS (Computerised Documentation Systems/Integrated Set of Information Systems), is a textual database management system designed to build and manage textual databases Database...
- 17
- 343
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
Ngày tải lên :
18/06/2014, 19:20
... in separate PCRs, both with pCRII-hNIS-1 as the template The respective PCR products were then mixed and used as the templates in one reaction with hNIS-5 and hNIS3 as the primer pair The final ... therapy, as well as distribution and replication of the oncolytic virus, and would alleviate the need for multiple and repeated tissue biopsies VACV is arguably the most successful biologic therapy ... shown not to be the case with some other viruses such as adenoviruses [1] It has fast and efficient replication, and cytoplasmic replication of the virus lessens the chance of recombination or...
- 14
- 490
- 0
báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx
Ngày tải lên :
20/06/2014, 03:20
... in separate PCRs, both with pCRII-hNIS-1 as the template The respective PCR products were then mixed and used as the templates in one reaction with hNIS-5 and hNIS3 as the primer pair The final ... therapy, as well as distribution and replication of the oncolytic virus, and would alleviate the need for multiple and repeated tissue biopsies VACV is arguably the most successful biologic therapy ... shown not to be the case with some other viruses such as adenoviruses [1] It has fast and efficient replication, and cytoplasmic replication of the virus lessens the chance of recombination or...
- 14
- 393
- 0
Báo cáo hóa học: " ‚Die DFG-Broschüre ‚Grüne Gentechnik‘ genügt ihrem eigenen Anspruch nicht‘ The booklet “Genetically modified crops“, published from the German Research Foundation, does not meet the given claim" pot
Ngày tải lên :
21/06/2014, 06:20
... degraded in nature, the genetic platforms containing resistance genes are auto-replicative elements that might be rather stable‘ [17] In ihrem Beitrag ‚Genetically modified organisms: the benefits ... eingehalten, da keine staatliche Kontrolle vor Ort stattfindet und die privaten Beratungsorganisationen der multinationalen Konzerne erheblichen Einfluss auf staatliche Organisationen ausüben [10] ... ‘We know that pollution by antibiotics and antibiotic resistance genes can alter the environmental microbiota Nevertheless, we ignore whether part of these alterations might remain over the long...
- 12
- 238
- 0
The world does not progress, it merely changes. ppt
Ngày tải lên :
22/07/2014, 04:20
... level as their barbarian predecessors in their relations with one another Fearing and distrusting one another, they lock up a huge amount of their productive wealth in armaments, to their own ... impoverishment They stand armed to the teeth, ready to destroy one another and their common civilization with the devilish weapons which their science has placed in their hands There is change, ... since Tennyson dreamt of The Parliament of Man, the Federation of the World” It is still only a dream Mankind has not had the wisdom to learn the elementary lesson of cooperation on a world scale...
- 5
- 415
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
Ngày tải lên :
09/08/2014, 01:23
... were not changed whereas oxidative stress was ameliorated by nifedipine is consistent with the hypothesis that VEGF signalling is impaired in SSc Our results also not support the implication of the ... sVEGFR-1 concentrations Whereas it cannot be excluded that nifedipine does not target the VEGF pathway, this apparent lack of change supports the hypothesis Table Serum concentrations of vascular ... Nifedipine treatment ameliorated endothelium injury in patients with SSc, as shown by the concentrations of adhesion molecules and oxidative damage markers The fact that VEGF and sVEGFR-1 concentrations...
- 6
- 518
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
Ngày tải lên :
09/08/2014, 10:23
... RNase-free water, and the mixture was then incubated for 10 minutes at 70°C to denature the total RNA The sample was then incubated for two minutes on ice to allow the primers to anneal and then spun ... study the therapeutic effects of systemic infliximab therapy on the synovial expression of other important pro-inflammatory molecules [38,47] Infliximab treatment in another small cohort of patients ... protein in the synovia during therapy could be detected, but there was no correlation with the clinical course of individual patients In the group of six patients who responded to therapy, three...
- 8
- 529
- 0
Báo cáo y học: "Disruption of the thrombospondin-2 gene alters the lamellar morphology but does not permit vascularization of the adult mouse lumbar disc" pdf
Ngày tải lên :
09/08/2014, 10:23
... vasculature was therefore seen in the TSP-2-null mouse tissue in the margin of the disc It is interesting to note that the previous investigators also showed that the differences seen in neonatal ... participated in the design of the study, secured funding, contributed to the design and coordination of the study, and participated in data interpretation and extensive preparation and revision of the ... vascularity of the adult annulus Our studies show that, even in the absence of expression of the TSP-2 gene, vascular ingrowth into the body of the disc did not occur The results of the quantitative assessment...
- 9
- 317
- 0
Báo cáo khoa hoc:" The CTGF -945GC polymorphism is not associated with plasma CTGF and does not predict nephropathy or outcome in type 1 diabetes" pptx
Ngày tải lên :
11/08/2014, 07:21
... been noted in previous studies that could not always confirm the originally observed association of the -945GC SNP with Ssc [4,5] Although, theoretically, population differences might affect the ... carried out the genotyping assays, analyzed the data and wrote the manuscript TQN participated in the design of the study and helped revise the manuscript LB helped set up the genotyping assay ... SNPs to disease manifestations, one of these reports examined a large number of patients of diverse nationality and ethnicity but could not replicate the association of the G allele with SSc [6]...
- 4
- 304
- 0
Báo cáo khoa hoc:" Human MMP28 expression is unresponsive to inflammatory stimuli and does not correlate to the grade of intervertebral disc degeneration" doc
Ngày tải lên :
11/08/2014, 07:21
... (IFN-g, IL-1b) did not influence its expression levels at all [37] All this data indicates that compared to other MMPs, MMP28 seems to be rather unresponsive to external inflammatory stimuli in ... point, one concentration that is typically used in the literature was chosen for each inflammatory mediator and cellular behavior was investigated Discussion Our results indicate that MMP28 is expressed ... these experiments All concentrations of all chemicals were shown to be non-toxic in advance using the MTT assay (data not shown) MMP28 mRNA detection in isolated human IVD cells after stimulation...
- 7
- 340
- 0
Báo cáo khoa hoc:" The contrast-enhanced Doppler ultrasound with perfluorocarbon exposed sonicated albumin does not improve the diagnosis of renal artery stenosis compared with angiography" pptx
Ngày tải lên :
11/08/2014, 08:20
... [17] The same examiner performed all examinations and the confirmation of the presence of stenosis was done in consensus with Page of (page number not for citation purposes) Journal of Negative ... ultrasound examination from all patients Results Patient Characteristics All patients underwent digital subtraction angiography and non-enhanced US One patient did not receive the infusion of ... in the Table The patients with stenosis were older than patients with no stenosis (p = 0.013), while we did not observe differences in the other demographic and clinical data Feasibility Overall,...
- 6
- 265
- 0