the structure of a data warehouse
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph parametrized by a sparse matrix W, a matrix with ... based on a positive class of linear functions and the other on a general class of linear functions The accuracy of this LP-based approach for deducing the structure of networks is assessed statistically...
- 15
- 392
- 0
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according to the protocols of the TCP/IP suite Data - Application layer ... Frame Header IP Header Data App TCP Header Header Frame Trailer Data Message: Data Multiple protocols 26 Multiple protocols (encapsulated) HTTP Header Protocols Frame Header IP Header Data App TCP...
- 52
- 550
- 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
... pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces cerevisiae) and based on the related mRNA expression time-series data from Stanford Microarray Databases Results Inferring the ... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... intervention of other nodes or parameters Sontag et al [15] have proposed another complementary method based on time-series measurements, which can be useful when stationary data are not available and the...
- 10
- 375
- 0
the meaning and structure of a narrative a systemic functional analysis
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and 21 Hasans...
- 39
- 826
- 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...
- 18
- 712
- 4
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... composed of two domains: an a ⁄ b domain and an a domain (Fig 1A) The known activesite motif is found in a cavity between the two domains The a ⁄ b domain consists of a central six-stranded b sheet of ... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] Other ... wild-type and DQCR10 strains (Fig 2C) Such an analysis demonstrated that all the bc1 subunits were present in comparable amounts in both yeast strains Therefore, the reason for the disappearance of the ... respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found in this mutant strain when the...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt
... al from the ratio of the forward scattering intensity of the sample and that of the molecular mass standard BSA The ab initio deconvolution of the SAXS profiles to restore a low-resolution shape ... microbial PLDs lack such probably regulatory domains Despite the increasing amount of primary structural data for PLDs, there is almost no information on the secondary and tertiary structures of plant ... surface structure of the enzyme was investigated by small-angle X-ray scattering (SAXS) Further structural information was obtained by the spectroscopic characterization of PLDa2 in the native...
- 11
- 750
- 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... The N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conformation, and the two C-terminal domains are cleaved off by heat treatment at 50 °C An Ala-Pro-Thr ... from a Serratia sp R Helland et al Structure in the binding region The electrostatic surface calculated by icm (Fig [28]) shows that the bacterial peptidases have a more anionic character than the ... SPRK also has an aspartic acid residue at position at 200, and with the same conformation as in the two other structures, but Asp200 forms a salt bridge to Lys253 (Ala253 and Asn250 in PRK and...
- 11
- 551
- 0
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... which assumed no information in the essay Note that the actual dialogue depends on the correctness of the user answers After the dialogue, users were asked to revise their essay and then the system ... addition, the SIH is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser ... Note that Figure is not a screenshot of the actual system interface The NM is the only part from the actual system interface Figure shows the NM after turn Tutor1 We manually annotated each system...
- 8
- 515
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unrefined subset of the data (5% of the data) a the metal ... 2007 The Authors Journal compilation ª 2007 FEBS 3129 Structure of S agalactiae STP A M K Rantanen et al B Fig (A) Structure of the SaSTP (monomer C) The protein was drawn using a secondary structure ... single-wavelength anomalous dispersion ˚ (SAD) data at the selenium peak wavelength (0.97935 A) and analyzed it using xds [24] (Table 2) Data were collected at 100 K using radiation from the European...
- 10
- 542
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Inside the Structure of Defined Contribution/401(k) Plan Fees: A Study Assessing the Mechanics of the ‘All-In’ Fee pot
... In the report, Exhibit plots the impact of average account balance and number of plan participants on the ‘all-in’ fee for a variety of combinations of average account balance and number of plan ... as a percentage of assets) The primary drivers6 of a plan’s overall level of fees were: •Plan size as measured by number of participants; •Average participant account balance in the plan; and ... •Average participant account balance in the plan Plans with more participants and plans with higher average participant account balances tended to have lower ‘all-in’ fees (as a percentage of...
- 38
- 799
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of Hb A0 produced by the LPSs of rough and ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the...
- 6
- 748
- 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
... demonstrate the presence of positive charge Figure 4I shows the bottom face (same as in Fig 4C) of a van der Waals model of the best structure of RIIa D/D The central part of this face appears to ... understand the structural properties of the charged face, we have performed pKa calculations on the ensemble of 24 structures of RIIa D/D Figure presents a plot of the calculated apparent mean pKa ... N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been observed in another...
- 12
- 536
- 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
... and T brucei apocytochrome c (J W A Allen, unpub2826 A Normalised absorbance of the alanine of the AXXCH motif (Ala25) (in green) and the unsaturated vinyl group of the heme ˚ (cyan) are separated ... free-living phagotrophic flagellates (e.g Bodo saltans), photosynthetic algae (e.g Euglena gracilis), and parasitic trypanosomatids [e.g the causal agents of the tropical diseases African sleeping ... ceased within a few seconds (Fig 1) A very similar result was obtained if mm KCN was added instead of antimycin A; cyanide inhibits the cytochrome aa3 oxidase of the classic respiratory chain,...
- 11
- 513
- 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
... Although a precise analysis of the mode of action of Xgh7 4A has not been performed, Xgh7 4A appears to be an endoglucanase because it has an open cleft Comparison of the XEG and OXG-RCBH active sites ... calculated from a plot of initial reaction rates versus substrate concentration using Prism (GraphPad Software, San Diego, CA, USA) One unit was defined as the amount of enzyme that released lmol of ... Reykjavik, Iceland), and were refined by varying the pH of the buffer and the concentration of the precipitant Prior to data collection, a crystal was transferred into Analysis of substrate specificity...
- 7
- 361
- 0
Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf
... 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ D341N-1 5’-AAGGGGAGAACTCAACGGAACACCGGAGG-3’ 5’-CACTCTCGAAGAGTTCATAAACGAAGTGAAGAAGAATCTC-3’ 5’-GAGATTCTTCTTCACTTCGTTTATGAACTCTTCGAGAGTG-3’ F205M D36N ... 5’-CCTGGAGAAATCGATCATGAGCTTCGCTCAGTCGTG-3’ 5’-CACGACTGAGCGAAGCTCATGATCGATTTCTCCAGG-3’ 5’-AAAAGGTCGACATCTGGATGGCGACGAAAGACACGATC-3’ 5’-GATCGTGTCTTTCGTCGCCATCCAGATGTCGACCTTTT-3’ D36N-1 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ ... oxygen of Asp270 and Asp247¢ represented the equatorial ligands, whereas Asp270 and Asp274 were the axial ligands Cofactor binding The b-decarboxylating dehydrogenases share a unique cofactor-binding...
- 18
- 410
- 0
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt
... classification of cellulases Eur J Biochem 258, 200–206 68 Takashima, S., Iikura, H., Nakamura, A. , Hidaka, M., Masaki, H & Uozumi, T (1998) Isolation of the gene and characterization of the enzymatic ... (5¢-GCATTCCTGCCATGTCAG-3¢) to generate sequence data for the 5¢ region upstream of the ATG start codon Expression of cel7 in E coli Primers F1 (5¢-CACCCAGCAGGCCGGCACGGCG-3¢) and R1 (5¢-TCACGAAGCGGTGAAGGTCGAGTT-3¢), ... interactions were 0.6 per 100 residues, a- carbon tetrahedral distortion was 1.8°, the standard deviation of the hydrogen bond energies was 0.7 and overall G-factor, a measure of the normality of the...
- 12
- 553
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... lipopolysaccharide gave a pellet and an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet (2) obtained on ultracentrifugation ... chromatography on a Sephadex G-50 column gave a major O-polysaccharide peak at the void volume (O-polysaccharide) and a minor peak just after The material in the major peak was devoid of neuraminic ... repeating unit of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that the...
- 7
- 463
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25