the significance of radiobiology and radiotherapy for cancer treatment

... [23] and not incorporate items on the effect of a cancer diagnosis and treatment, such as fatigue and anxiety To measure QWL among cancer survivors, and to take account of the impact of cancer ... Amsterdam, the Netherlands Full list of author information is available at the end of the article than ‘healthy’ employees [4] for example, and when cancer survivors are employed, they report ... The data entry for two of every ten (20%) paper versions of the QWLQ-CS was checked by exporting the data to SPSS and calculating the margin of error If ≥2% of the data entry was wrong, all of

Ngày tải lên: 23/07/2020, 02:27

... to the office liaison about the importance of not disclosing the identity of the SP to anyone in the office who might inform the physician If the practice has been closed to new patients, the ... care Understand Prognosis: Assessing the patients’ understanding of their prognosis Changing for the Worse: Discussion of how the disease trajectory is changing for the worse Quality of Life: Discussion ... activated and black typical (non-activated), or b) white activated and white typical; the order of presentation of the SPs is randomized, such that half of the physicians see the activated SP first, and

Ngày tải lên: 06/08/2020, 05:05

... constructed by the student and the supervisor on the basis of the mutual understanding of their respective roles in the completion of the work built in advance In other words, the task of writing a thesis ... demands of the kind of writing in a thesis Regarding the possible difficulty the students have to face, Bhandari (2013) writes: When the students enter into the process of thesis writing, they ... process together with their supervisor so that they can cross it The results or findings of this research could be the basis for the hands-on supervision, where ? ?the aims and expectations of candidature

Ngày tải lên: 10/01/2020, 08:23

... difficulties Therefore, we conduct research ? ?The status of production and demand for organic vegatables in Hanoi”, in order to investigate the status of production and consumption of OV products, ... on food hygiene and safety, the quality of agricultural products and the environment are increasing, the demand for organic products is increasing With the active advocacy of the Vietnam Organic ... 40 types of vegetables, fruits and spices, the number and types of substitutes supplied to the market vary depending on the time of year Some types of vegetables are often supplied to the market

Ngày tải lên: 13/01/2020, 08:51

... heavily weighted and therefore make a greater contribution to the VFI than those in the periphery [4,15,17] For the patients with VFIs 90% and above, the correlation with the MD and with the PSD was ... CYP2C19*3 and PlA2 as the most important alleles responsible for the resistance to clopidogrel and aspirin therapy, we did not study the prevalence of other non-functional CYP2C19 alleles Further ... * 3) approximately 52,5% of the study population and 10% of the study population were PLA1/A2 heterozygotes of ITGB3 gene Therefore, the prevalence of antiplatelet therapy nonresponse is higher

Ngày tải lên: 22/01/2020, 14:38

... countries in the world are facing with great challenges of lack of labors with high quality and professional skills meeting the demand of human resources for the fourth industrial revolution Therefore, ... because they work 24/7 and they not need days off, 365 days, not need other types of costs Machines make faster, better quality and importantly, is cheaper” In Vietnam, the appearance of the Grab and ... labor supply and demand worldwide and the risk of unemployment The economy with a high degree of automation and creativity requires workers to adapt quickly to the change of production or they will

Ngày tải lên: 23/07/2020, 01:41

... research The only “accounting assets” may be computers and office furniture The “real assets” are the billable professionals and their support staff who constitute the value of the business The key ... Total Number of Employees is a function of the value-added nature of the business, the relationship between billable and non-billable employees, and the overall efficiency of the firm For each billable ... providing the service, operating and staff expenses, and the costs of any services or functions that the profit center outsources to others The expenditures must be incremental to the profit center They

Ngày tải lên: 22/09/2020, 22:37

... importance, either at present or in the future It is particularly significant for very new and, at the other end of the life-cycle spectrum, very mature products Before we get to mathematical formulas, ... However, before the unit can be sold, it must be manufactured at a cost of $35 The difference between the selling price and the variable cost per unit is called the contribution margin Therefore, the ... assistance of manufacturing and engineering analyses of the production facility and administrative departments Each of the per-unit costs is then multiplied by the expected number of units to

Ngày tải lên: 22/09/2020, 22:38

... arrived during the final decade of the 20th and the first years of the 21st century from the former Yugoslavia, the former Soviet union, Iraq and Somalia [5] According to data from the Swedish National ... groups since for some children and adolescents, the available data refer only to the region of origin (e.g other Asian) In the analysis, the ethnicity measure is employed in the form of five dummy ... influences both the personalities and lifestyles of the individuals who live there, and also their routine behaviours This implies that the characteristics of the neighbourhood of residence may influence

Ngày tải lên: 22/10/2020, 21:56

... strongly dependent on the size, shape, and impurities of metal nanoparticles The rates of electrocatalytic oxidation of CO and methanol strongly depend on the structure of the catalyst The electrocatalytic ... stability and activity of electrodes for the MOR, attributed to the bifunctional mechanism of Ru to Pt The amount of catalyst loading is critical for the improvement of MOR activity For instance, Wang ... Pt-rich Pt-Ru alloys and PtRu@C catalysts with 20% Ru content exhibited the highest catalytic activity for the MOR The effect of concentration and temperature for the enhancement of the MOR was also

Ngày tải lên: 12/01/2022, 23:36

... to express their understanding and awareness about the lesson topic and about the world around them In the fundamental and comprehensive reform of education, the Ministry of Education and Training ... 0987634745 TABLE OF CONTENT PART 1: INTRODUCTION Rationale of the study Aims and Significance of the study Scope of the study Methods of the study PART 2: CONTENT CHAPTER 1: THEORETICAL AND PRACTICAL ... understanding for gaining information 1.1.6 The roles of the teacher and students in project-based learning The roles of the teachers in project-based learning are different from that of teachers

Ngày tải lên: 27/07/2023, 10:05

... were then told the water was unsafe for use in baby formulas, for the elderly, and for the sick (Foller, 2003) As women are overwhelmingly the caregivers for infants and for the sick and frail, these ... facility because of concerns about the water source and the design of the treatment plant (Office of the Auditor Women and Health Care Reform and NNEWH – Women and Water in Canada General of Canada, ... most parts of the world, women are the majority of water providers for their families and are responsible for obtaining safe drinking water (Kattau, 2006) Women often the budgeting for the various...

Ngày tải lên: 13/02/2014, 06:20

... changes in the Office of the Secretary of iii iv The Acquisition of Drugs and Biologics for CBW Defense Defense (OSD) to centralize the authority for interactions between DoD and FDA The interviews ... information about the composition or chemical structure of the drug or biologic; how the compound is manufactured; the methods of testing for safety (and for purity and potency in the case of ... recipients of IND drugs, medical monitoring and reporting of the use of such drugs, information about shipment and storage of drugs, disposition of unused IND drugs, and submission of annual and other...

Ngày tải lên: 17/02/2014, 11:20

... place when the owners of the company leave the profits of the company in the business rather than taking the money out of the company in the form of dividends The cumulative amount of this reinvestment ... letter of credit, or in the case of a supermarket or retail store, cash On the other hand, as part of the selling process, the customer may be given the opportunity to postpone paying for the products ... balance sheet date, and so the company owes them three days’ pay To reflect the existence of these debts, the company estimates their amounts as of the balance sheet date and records them in an account...

Ngày tải lên: 22/02/2014, 06:20

... cancer prevention [39–41] However, the development of effective and safe agents for the prevention and treatment of cancer remains inefficient and costly, and falls short of the requirements for ... significantly absorbed in the intestinal tract, and reach the colon mainly intact [27] They are therefore bioavailable to the epithelial cells in the intestinal wall, where procyanidins and other phenolics ... investigated the relationship of different structural factors of procyanidins, such as the mean degree of polymerization and percentage of galloylation, with their antiproliferative potential and their...

Ngày tải lên: 07/03/2014, 05:20

... and are therefore not subject to the cell-cycle arrest function of Vpr and even lack the prerequisite ATR induction in the presence of Vpr [132] The findings that demonstrate the importance of ... the minor and Page of 20 severe forms of HAND have common etiologic mechanisms, there is reason to suspect the importance of HIV infection in macrophages in the central nervous system (CNS) and/ or ... combination with the aforementioned abilities of Vpr to increase viral replication by inducing G arrest and activating the HIV-1 LTR, the potential of Vpr to promote infection of and survival of macrophages...

Ngày tải lên: 13/08/2014, 01:20

... arrived during the final decade of the 20th and the first years of the 21st century from the former Yugoslavia, the former Soviet union, Iraq and Somalia [5] According to data from the Swedish National ... groups since for some children and adolescents, the available data refer only to the region of origin (e.g other Asian) In the analysis, the ethnicity measure is employed in the form of five dummy ... designed the study, performed the statistical analysis and wrote the manuscript with support from the other co-authors RS helped with the interpretation of the statistical analysis, revised the manuscript...

Ngày tải lên: 13/08/2014, 18:21

... aspects of study design, performance, and analysis, with a focus on randomization of the study subjects, blinding of the investigators and study subjects, and the handling of dropouts and withdrawal ... is the common name for the flowering plant, Hypericum perforatum L (Gaster and Holroyd, 2000), a member of the Hypericaceae family Its yellow flower has been gathered for the feast of St John the ... 2004), it is not known whether digoxin will remain as the standard therapy for heart failure (Hauptman and Kelly, 1999) In the future, there might be other uses for digitoxin There is evidence that...

Ngày tải lên: 25/10/2013, 05:20

... cycles of 94°C for 30 sec, 59°C for 45 sec and 72°C for 60 sec, and finally 72°C for The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse ... early studies of our group and others, the transcriptional regulatory sequences of the H19 and IGF2 genes emerged as candidates for cancer targeted therapy H19 and IGF2 (the human P3 and P4 promoters) ... (5’-TCCTCCTCCTCCTGCCCCAGCG), for the P4 transcript in the forward direction and the reverse primer (5’- CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns...

Ngày tải lên: 18/06/2014, 16:20