The response to clopidogrel and aspirin in patients is known to be highly variable as bioavailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin. Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy. The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene (PlA1/ A2).
JOURNAL OF MEDICAL RESEARCH RAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOGREL AND ASPIRIN FOR PCI STENT GRAFT PATIENTS Nguyen Thi Trang, Luong Thi Lan Anh , Vu To Giang , Do Duc Huy, Nguyen Thi Minh Ngoc, Department of Biomedical and Genetics, Hanoi Medical University, Hanoi, Vietnam The response to clopidogrel and aspirin in patients is known to be highly variable as bioavailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene (PlA1/ A2) The real-time PCR method using SYBR green was validated against the Sanger’s sequencing method described previously and used to determine the frequency and type of mutations of postPCI patients The results indicated that patients carrying any CYP2C19 loss-of-function alleles had a higher event rate (52.5%) of the study group: 10% homozygous and 35% heterozygous (CYP2C19 *2); 7.5% heterozygous carriers (CYP2C19*3) Carriers of the Leu33Pro polymorphism of ITGB3 gene accounted for approximately 10% of the study population In conclusion, a genotyping variant of CYP2C19 and ITGB3 provides an excellent opportunity for optimizing the anti-platelet regimen post-PCI Keywords: coronary artery disease, CYP2C19, clopidogrel, ITGB3, aspirin resistance I INTRODUCTION Coronary artery disease (CAD) is the most common type of heart disease It is the leading cause of death in the world in both men and women [1] In Vietnam, coronary artery disease has been increasing rapidly in recent years Percutaneous coronary intervention (PCI) is one of the most common medical procedures performed for treatment of CAD Corresponding author: Nguyen Thi Trang, Department of Biomedical and Genetics, Hanoi Medical University Email: trangnguyen@hmu.edu.vn Received: 03 June 2017 Accepted: 16 November 2017 JMR 111 E2 (2) - 2018 Dual antiplatelet therapy with aspirin and a P2Y12 receptor antagonist including clopidogrel is the standard of care in patients undergoing PCI and in patients with acute coronary syndromes (ACS) because this regimen has markedly decreased the rate of cardiovascular events However, the substantial variability in pharmacodynamics response, as well as the moderate antiplatelet efficacy of clopidogrel and aspirin, has raised major concerns Many researches have focused on the impact of genetic polymorphisms encoding transport systems or enzymes involved in the absorption and metabolism JOURNAL OF MEDICAL RESEARCH of these drugs An ESC Guidelines class II recommendation has been given for the management of acute coronary syndromes patients (2011) to perform genotyping in high-risk PCI patients if a change in the antiplatelet therapy will ensue based on the test results [2] Loss-of-function polymorphisms in CYP2C19 are the strongest individual variables affecting pharmacokinetics and antiplatelet response to clopidogrel CYP2C19 G681A (*2) and CYP2C19 G636A (*3) alleles are associated with CYP function reduction, impaired clopidogrel responsiveness and increased subsequent post-PCI ischemic outcomes [3 - 5] The GPllb/llla receptor is a key regulator of platelet aggregation Consequently, polymorphisms within the GPllb/llla receptor have been of great interest with regard to aspirin resistance, the most commonly investigated being the PlA1/A2 SNP (Leu33Pro) [6] Some studies have suggested an association between the presence of the PlA2 allele and increased platelet activity, as determined by platelet aggregation and/or fibrinogen binding [7 10] The Realtime - PCR method is an accurate way of defining polymorphism, with the advantage of relatively simple, fast-paced techniques that have opened up new possibilities for applying this technique as a routine test before indications of clopidogrel and aspirin therapy for PCI patients The aim of this study was to investigate the frequencies of CYP2C19 G681A (*2; rs4244285), CYP2C19 G636A (*3; rs4986893) and PlA1/ PlA2 (T1565C, rs5918) polymorphisms of CYP2C19 and ITGB3 gene in study subjects by Realtime - PCR technique II MATERIALS AND METHODS Sample collection: 40 patients undergoing PCI procedure with coronary artery disease were offered the genetic test by the treating cardiologist to identify CYP2C19 and ITGB3 genotype All patients were treated with an aspirin (325 mg) and clopidogrel (600 mg) loading dose before the procedure Method: About ml of venous blood were collected in a tube containing EDTA Peripheral blood leucocytes were separated by centrifugation DNA was extracted from peripheral blood with DNA Expression Kit (Lytech, Russia) Realtime - PCR technique was used to identify polymorphism of CYP2C19 gene (CYP2C19*2 , CYP2C19*3) and ITGB3 gene (PlA1 / PlA2) The primers used for PCR of each polymorphism are given in Table 1: JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH Table FP - Forward primer, ASP - Allele specific primer, RP- Reverse primer Gene CYP2C19*2 (G681A) CYP2C19*3 (G636A) Leu33Pro (T1565C) Primer FP 5’ – CCCACTATCATTGATTATTTCTCG – 3’ ASP 5’– CCCACTATCATTGATTATTTCTCA-3’ RP 5’ – ACGCAAGCAGTCACATAACTA – 3’ FP 5’ – GGATTGTAAGCACCCCCAGG – 3’ ASP – GGATTGTAAGCACCCCCAGA – 3’ RP 5’ – TCACCCCATGGCTGTCTAGG – 3’ FP 5’ – GCTCCAATGTACGGGGTAAAC – 3’ ASP 5’ – GCTCCAATGTACGGGGTAAAT – 3’ RP 5’ – GGGGACTGACTTGAGTGACCT – 3’ Realtime - PCR technique was performed on CFX96 (BioRad, USA) The cycling programmer involved preliminary denaturation at 93°C for min, followed by 35 cycles of denaturation at 93°C for 10 seconds, annealing at 64°C for 10 seconds, and elongation at 72°C for 20 seconds followed by a final elongation step at 72°C for Using the DNA-express kit for DNA extraction and Realtime Techniques - Genomic PCR and mutation analysis are time-saving methods: saving an average of 45 minutes for DNA extraction and 90 minutes for gene polymorphism This technique is therefore highly applicable in clinical practice to quickly and accurately identify patients' genotypes prior to the introduction of the regimen as well as the dose of clopidogrel and aspirin Statistical analysis The continuous data were presented as mean and standard deviation (SD) The statistical analyses were conducted using SPSS (SPSS Statistics for Windows, Version 17.0 Chicago: SPSS Inc.) Ethics All patients were duly informed of the benefit of such a test and were asked to sign an informed consent form before blood collection Ethical clearance was obtained from the Hanoi Medical University Institutional Ethics Committee III RESULTS Characteristics of the study population There were 40 patients enrolled in the study ranging in age from 39 to 79 years, the majority were men (85%) Patients with high risk factors for cardiovascular disease were relatively many, including hypertension (72.5%) and hypercholesterolemia (32.5%) (Table 2) JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH Table Characteristics of the study group Characteristics n % Male 34 85 Female 15 Hypertension 29 72.5 Diabetes mellitus 22.5 Hypercholesterolemia 13 32.5 Stents ≥ times 17.5 Mean SD 62.6 9.5 Gender Age(Year) CYP2C19 and ITGB3 polymorphism detection rates using Realtime – PCR technique Table indicated that the rates of CYP2C19*2 and CYP2C19*3 polymorphisms in the study group were relatively large: 52.5% of patients carrying at least one CYP2C19 allelic variant reduced the function of clopidogrel metabolism In addition, 10% of patients had ITGB3 polymorphism associated with aspirin resistance Table CYP2C19 and ITGB3 polymorphism detection rates using Realtime - PCR Gene CYP2C19 CYP2C19 *2, *3 Characteristic ITGB3 PlA1/ PlA2 Gender n % n % Male 16 47.1 8.8 Female 66.7 16.7 Total 21 52.5 10 Genotype frequencies of study subjects Table shows that the number of patients with CYP2C19*2 allele accounted for 45%, mainly heterozygous (35%), homozygotes (10%) 7.5% of patients with CYP2C19*3 allele, all of them are heterozygous 10% of patients carry PlA2 alleles - all of them are heterozygous JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH Table Genotype frequencies of study subjects Genotype frequency Wild type Gene Allele frequency Hetero zygous Homozygous Wild type allele Mutant allele n % n % n % n Freq n Freq CYP2C19*2 (G681A) 22 55.0 14 35.0 10 681G 0.725 681A 0.275 CYP2C19*3 (G636A) 37 92.5 7.5 0 636G 0.9625 636A 0.0375 PlA1/PlA2 (T1565C) 36 90.0 10.0 0 1565T 0.95 1565C 0.05 IV DISCUSSION The combination of aspirin and clopidogrel is the mainstay anti - platelet strategy for preventing ischemic events after PCI However, many studies have shown resistance to aspirin and clopidogrel, which reduces the effectiveness of treatment According to Boris T et al (2009), the rate of no responsiveness to aspirin varied from 5% to 60%, with clopidogrel 6% -25% and both drugs 10.4% [11] In Vietnam, according Do Quang Huan (2013), in 174 patients with coronary artery disease enrolled in the study, the prevalence of nonresponse to aspirin and clopidogrel were 21.3% and 26.4% [12] According to Ibrahim O (2013), aspirin resistance/ non-responders in their study at acute coronary syndrome patients accounted for 4.69% while non-responders to clopidogrel accounted for 21.9% [13] Thus, studies on factors related to clopidogrel and aspirin resistance, particularly genetic factors, are essential in the prevention and treatment of JMR 111 E2 (2) - 2018 coronary heart disease Several polymorphisms of the CYP2C19 gene have been identified and they produce an inactive enzyme Two inactive genetic variants (CYP2C19*2 and CYP2C19*3) account for more than 95% of cases of poor metabolism of the relevant medications [14] The genotypes were distributed as good or normal metabolizers (CYP2C19*1/*1; also called extensive metabolizers in literature), intermediate (*1/*2; *1/*3, *2/*17, and *3/*17), poor (*2/*2 and *3/*3), rapid (*1/*17), and ultra-rapid metabolizers (*17/*17) In our study, more than half of the study population carriers of at least one CYP2C19 loss-of-function allele (CYP2C19 * or CYP2C19 * 3) The results of our study were similar to those found in Liu Mao’s study (2013): about 55% of Asians have one or more loss-of-function allele of CYP2C19 [15] Among them, the frequencies of heterozygous CYP2C19 G681A (*2) in our JOURNAL OF MEDICAL RESEARCH study was 35% (14 patients), the frequencies of heterozygous CYP2C19 G636A (*3) was 7.5% (3 patients) Poor metabolizers, with both alleles being mutated and hence unable to metabolize clopidogrel, formed 10% of the population (4 patients), all of them are homozygous CYP2C19 *2 Thus, the intermediate metabolizers and the poor metabolizers of clopidogrel are relatively large As recommended by the American Association for Clinical Pharmacology and Clinical Pharmacy (ASCPT) in 2013 for the use of platelet antiplatelet drugs [16]: it is necessary to consider alternative treatment sor treatment strategies in patients identified as CYP2C19 intermediate metabolizers and poor metabolizers Therefore, identifying the genotype of an individual before taking clopidogrel is necessary to achieve its optimal anti-platelet activity In addition, our study identified that patients (10% of study population) were PLA1/A2 heterozygotes No PLA2 homozygotes were found in the study group No patients carry the PlA2 / PlA2 homozygous genotype According to a study by Sperr W R et al (1998), in central Europeans, the PlA1/A2 allele is present in 20-30 % of people and the PlA2/A2 allele is present in 1-3 % of people [8] It has been shown that platelets containing PlA1/ A2 or PlA2/A2 alleles are more reactive than homozygous PlA1/A1 platelets with enhanced thrombin formation and a lower threshold for activation, granule release, and fibrinogen binding, and therefore will have a variable response to the antiplatelet effects of aspirin [9; 10] Results from our study indicate high prevalence of mutations that would alter the normal function of the CYP2C19 gene in metabolizer clopidogrel Our study also found that the small rate of individuals with the PlA2 allele of SNP rs5918 of the ITGB3 gene reduces the response to aspirin Variability or resistance to aspirin or clopidogrel has been demonstrated using various in vivo biomarkers and ex vivo platelet function tests Accumulating data suggested that patients with resistance are at high risk for ischemic events, including stent thrombosis Thus, cardiologists have focused much attention on the adequacy of antiplatelet regimens Study limitations: First and foremost, among the limitations of the present study is its small sample size and absence it a control group, although we tried to overcome this shortcoming by matching the cases We calculated our sample size based on the frequency of the CYP2C19*2 alleles in the Vietnam population However, our achieved power was markedly reduced due to the low frequency of the non-functional allele in our study population Moreover, while we focused on CYP2C19*2, CYP2C19*3 and PlA2 as the most important alleles responsible for the resistance to clopidogrel and aspirin therapy, we did not study the prevalence of other non-functional CYP2C19 alleles Further cohort studies with larger samples and on different ethnicities in the Vietnam population are required to determine the effects of the CYP2C19 and ITGB3 polymorphism on the prognosis of CAD patients who have undergone PCI and are receiving dual antiplatelet therapy JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH V CONCLUSION In our study, carriers of at least one CYP2C19 loss-of-function allele (CYP2C19 * or CYP2C19 * 3) approximately 52,5% of the study population and 10% of the study population were PLA1/A2 heterozygotes of ITGB3 gene Therefore, the prevalence of antiplatelet therapy nonresponse is higher in patients undergoing PCI The Realtime PCR technique is a fast, accurate and costeffective way to identify polymorphisms of CYP2C19 gene and ITGB3 gene, that are suitable for Vietnamese conditions, and is clinically relevant Using this method, the common mutations that cause changes in the bioavailability of clopidogrel and aspirin may be reliably identified and the medication and dosage adjusted accordingly Thus, this technique could be used as a routine test before treatment of dual – platelet for PCI patients Acknowledgments The authors would like to take this opportunity to extend our sincere thanks to Center of Genetics Couseling for providing financial support for the study We also are grateful for National Cardiovascular Institute for supporting us in identifying CYP2C19 and ITGB3 mutations REFERENCES Shanthi Mendis, Pekka Puska, Bo Norrving, (2011) Global Atlas on cardiovascular disease prevention and control World Stroke Organization, - C.W Hamm, J.P Bassand, S Agewall et al (2011) ESC guidelines JMR 111 E2 (2) - 2018 for themanagement of acute coronary syndromes in patients presenting without persistent ST-segment elevation: The task force for the management of ACS (acute coronary syndromes) in patients presenting without persistent ST-segment elevation of the ESC (European Society of Cardiology), Eur Heart J 32 (23): 2999 - 3054 Brant J.T., Close S.L, Iturria S.J et al (2007) Common polymorphysm of CYP2C19 and CYP2C9 affect the phamacokinetic and pharmacodynamic respone to clopidogrel but not prasugrel J Thromb Heamost 5: 2429 - 2436 Mega J L., Close S L., Wiviott S D., et al (2009) Cytochrome p-450 polymorphisms and response to clopidogrel N Engl J Med, 360(4), 354 - 362 Collet J P., Hulot J S., Pena A., et al (2009) Cytochrome P450 2C19 polymorphism in young patients treated with clopidogrel after myocardial infarction: a cohort study Lancet, 373(9660), 309 317 Newman P J., Derbes R S., Aster R H (1989) The human platelet alloantigens, Pl(A1) and Pl(A2), are associated with a leucine(33)/proline(33) amino acid polymorphism in membrane glycoprotein IIIa, and are distinguishable by DNA typing J Clin Invest 83: 1778 - 1781 Sirotkina OV, Khaspekova SG, Zabotina AM, Shimanova YV, Mazurov AV (2007) Effects of platelet glycoprotein IIb-IIIa number and glycoprotein IIIa Leu33Pro polymorphism on platelet aggregation and sensitivity to glycoprotein IIb-IIIa antagonists Platelets 18: 506 – 14 JOURNAL OF MEDICAL RESEARCH Sperr W R., Huber K., Roden M et al (1998) Inherited platelet glycoprotein polymorphisms and a risk for coronary heart disease in young central Europeans Thromb Res 90: 117 - 123 Undas A., Brummel K., Musial J et al (2001) Pl(A2) polymorphism of beta3 integrins is associated with enhanced thrombin generation and impaired antithrombotic action of aspirin at the site of microvascular injury Circulation 104: 2666 - 2672 10 Michelson A D., Furman M.I., Goldschmidt-Clermont P et al (2000) Platelet GP IIIa- PlA polymorphisms display different sensitivities to agonists Circulation 101: 1013 - 1018 11 Boris T I., Mareike Sausemuth H I., Evangelos G et al (2009) Dual Antiplatelet Drug Resistance Is a Risk Factor for Cardiovascular Events after Percutaneous Coronary Intervention Clinical Chemistry 55: 1171 - 1176 12 Đỗ Quang Huân, Hồ Tấn Thịnh (2013) Tỷ lệ không đáp ứng với điều trị thuốc chống kết tập tiểu cầu bệnh nhân can thiệp động mạch vành qua da Tạp chí Y học thực hành (878), số 8/2013, - 13 13 Ibrahim O, Oteh M, A Syukur A et al (2013) Evaluation of Aspirin and Clopidogrel resistance in patients with Acute Coronary Syndrome by using Adenosine Diposphate Test and Aspirin Test Pak J Med Sci, 29(1): 97 – 102 14 Yuanyuan Dong, Huasheng Xiao, Qi Wang et al (2015) Analysis of genetic variations in CYP2C9, CYP2C19, CYP2D6 and CYP3A5 genes using oligonucleotide microarray Int J Clin Exp Med 8(10): 18917 – 18926 15 Liu Mao et al (2013) Cytochrome CYP2C19 polymorphism and risk of adverse clinical events in clopidogreltreated patients: A meta-analysis based on 23035 subjects Archives of Cardiovascular Disease 106: 517 - 527 16 Scott S A., Sangkuhl K., Stein C M et al (2013) Clinical Pharmacogenetics Implementation Consortium guidelines for CYP2C19 genotype and clopidogrel therapy: 2013 update Clin Pharmacol Ther 94(3), 317 - 323 JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH STUDY ON THE HYPOGLYCEMIC ACTION OF CF2 IN INDUCED TYPE 2-LIKE DIABETIC MICE MODEL Ho My Dung¹, Vu Thi Ngoc Thanh¹, Pham Thi Van Anh¹, Nguyen Thi Thanh Ha¹, Nguyen Thi Minh Hang² ¹Hanoi Medical University ²Institute of Marine Biochemistry - Vietnam Academy of Science and Technology To investigate the hypoglycemic action of CF2 in a type 2-like diabetic mice model induced by high fat diet (HFD) combined with streptozotocin (STZ) injection Method: Model: mice were fed with HFD for weeks, then injected with a dose of STZ (100 mg/kg body weight, intraperitoneal injection) Animal used: Swiss male mice Drugs: type 2-like diabetic mice with HFD and STZ treated with either gliclazide 80 mg/kg body weight, CF2 m/kg or CF2 mg/kg body weight daily by oral route of administration during 14 days Result: CF2 has blood glucose-lowering effect in type 2-like diabetic mice for 14 days treatment at doses of mg/kg and 4mg/kg daily (p < 0.05) The blood glucose- lowering effect of CF2 at dose of mg/kg daily is similar to gliclazide 80 mg/kg daily CF2 at dose of 4mg/kg is more effective than that of mg/kg and gliclazide 80 mg/kg in reducing blood glucose level Conclusion: CF2 has effect on lowering blood glucose level at doses of mg/kg and mg/kg daily for 14 days in type 2-like diabetic mice, induced by HFD and STZ 100 mg/kg intraperitoneal injection Keywords: CF2, Callisia fragrans, ecdysteroid, type 2-like diabetic mice, STZ, HFD, blood glucose I INTRODUCTION The prevalence of diabetes mellitus is increasing at an alarming rate globally According to a World Health Organization report an estimated 422 million adults globally were living with diabetes in 2014, compared to 108 million in 1980 [1] The number of people with diabetes aged 20 - 79 years was Corresponding author: Ho My Dung, Hanoi Medical University Email: homydung@hmu.edu.vn Received: 15 June 2017 Accepted: 16 November 2017 JMR 111 E2 (2) - 2018 predicted to rise to 642 million by 2040 [2] The health consequences of diabetes can overwhelm the health care systems due to the severity of the long term complications of diabetes [1] Several oral hypoglycemic agent are available to lower blood glucose levels in diabetics However, their administration may cause side effects in patients [3; 4] Therefore, there is on urgent need to find new prevention strategies and treatments for diabetes Recently, many plant-based natural products that contain certain phytochemicals are being investigated anti-di9 JOURNAL OF MEDICAL RESEARCH abetic potential for their [5] Using an herbal remedy as an alternative therapy for diabetes treatment would reduce individuals dependence on synthetic oral hypoglycemic agents [6] The plant kingdom offers a wide field of possible effective oral hypoglycemic agents Basket Plant (whose scientific name is Callisia fragrans) has been used as a traditional therapy for pain, fever, digestive disorders, heart diseases, diabetes, cancers and many other airments [7; 8] CF2 powder is extracted from the leaves, stems and shoots of Basket Plant CF2 powder contains the active component ecdysteroid which can be used in treating diabetes; preventing inflammation and osteomalacia; protecting the nervous system; and improving the immune system [9; 10] However, adequate characterization of CF2 effect is yet to be done and no study has been performed using a type diabetes model The objective of this study was to evaluate the hypoglycemic action of CF2 in a model of induced type 2-like diabetic mice Type-2 like diabetes was individual by high fat diet (HFD) combined with streptozotocin (STZ) injection II MATERIALS AND METHODS Materials Experimental Medicine CF2 powder extracted from leaves, stems and shoots of Basket Plant was supplied by Institute of Marine Biochemistry, Viet Nam Experimental Animals Swiss male white mice, from - weeks 10 of age, and weighing between 23 - 27 grams, were used for this study The mice were obtained from National Institute of Hygiene and Epidemiology, Viet Nam The experimental animals were caged individually and acclimatised to laboratory conditions for weeks prior to the experiment The study was carried out at the Pharmaceutical Department of Hanoi Medical University Machines and Chemicals - Streptozotocin g (Sigma-Aldrich, Singapore), Buffer solution Citrate pH 4.5 - Diamicron (gliclazide) tablets 30 mg (Servier ,France) - Blood glucose monitoring system On Call EZII (ACON Biotech, USA) - Animal blood counter Vet Exigo (Bonle Medical AB, Sweden) - Chemistry analyzer Erba and Test strips: blood triglyceride, HDL-C, cholesterol (Transasia, India) Method The study was divided into two stages [5]: * The first stage: Before ending the study, all mice baseline fasting glucose levels checked from peripheral blood samples + Group 1: Control condition (n = 10) mice were randomized to one of two group: Normal fat diet regime (NFD) for weeks + Group 2: Diabetic condition (n = 70): High fat diet regime (HFD) in weeks following Fabiola and Srinivasan method with 43% saturated fat combined siro fructose 55% [6] After weeks, the fasting glucose level in all mice was checked Mice in group JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH Oncol, 42 (2), 453 - 459 20 Portugal J., Waring M J (1988) Assignment of DNA binding sites for 4′, 6-diamidine-2-phenylindole and bisbenzimide (Hoechst 33258) A comparative footprinting study Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression, 949 (2), 158 - 168 21 Goodell M.A., Brose K., Paradis G., et al (1996) Isolation and functional properties of murine hematopoietic stem cells that are replicating invivo J Exp Med., 183, 60 1797 – 1806 22 Goodell M.A., Rosenzweig M., Kim H., et al (1997) Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species Nat Med., 3, 1337 – 1345 23 Brown M.D., et al (2010) Identification of a cancer stem cell enriched side population using Hoechst 33342 based isolation Cancer Stem Cells JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH THE EFFECT OF LACTULOSE IN THE TREATMENT OF CHRONIC FUNCTIONAL CONSTIPATION IN CHILDREN Do Thi Minh Phuong, Nguyen Thi Viet Ha Department of Pediatrics, Hanoi Medical University Constipation is a common gastrointestinal problem in children The aim of the present study was to evaluate the beneficial effects of lactulose in the management of functional constipation in children An open clinical trial was conducted in 140 children aged – years at the National Children Hospital, Hanoi, Vietnam with a diagnosis of functional constipation The reslult suggest that frequency and consistency of defecation, as well as clinical symptoms were improved significantly when using lactulose with ml/ kg/day The mean weekly stool frequency improved from 1.9 ± 0.8 times to 4.9 ± 1.8 times after month and to 5.9 ± 1.4 times after months of treatment (p < 0.01) The rate of effective treatment (the weekly stool frequency ≥ times and fecal incontinence ≤ time every two weeks) was 68% after month and increased to 72.8% after and months of treatment In addition to using laxatives, fiber and fluid intake per day > 80% standard recommendation improve the effect in the treatment In conclusion, lactulose is a safe, effective and well-tolerated long-term treatment for constipation Regular supplement of fiber and fluid in children with constipation is important to improve the effect in the treatment of constipation Keywords: chronic functional constipation, lactulose, children, Rome III I INTRODUCTION Constipation is one of the mast common constipation digestive complaints in children, and has recently grown into a disproportionate public health problem A recent systematic review of pediatric patents of the sample reported constipation in 0.7% to 29.6% of the sample [1] Functional constipation was recognized as a separate clinical entity by combining features of functional Corresponding author: Do Thi Minh Phuong, Department of Pediatrics, Hanoi Medical University Email: dominhphuong@hmu.edu.vn Received: 13 August 2017 Accepted: 16 November 2017 JMR 111 E2 (2) - 2018 fecal retention and functional constipation The North American Society for Pediatric Gastroenterology, Hepatology and Nutrition define constipation as a delay or difficulty in defecation, present for or more week [2] The occurrence of chronic functional constipation in children can lead to significant abdominal pain, anal fissure, loss of appetite, faecal incontinence and social isolation The aim of constipation management is to produce soft, painless stools and to prevent the re-accumulation of feces, which can be achieved through dietary modification, behavioral interventions, fecal disimpaction and the use of laxatives, or a combination thereof [6] Lactulose is considered 61 JOURNAL OF MEDICAL RESEARCH to be safe and recommended for all ages in the management of constipation by NASPGHAN and ESPGHAN [3] Many studies have demonstrated that lactulose improved frequency and consistency of defecation and clinical symptoms [4; 5; 7; 8] To our knowledge, however, no large studies evaluat the effect of lactulose in childhood constipation have been published in Vietnam The primary objective of the present study was to evaluate the beneficial effects of lactulose in the treatment of chronic functional constipation in children II MATERIALS AND METHODS Subjects 140 children aged - years recruited from the sample consisted of the National Children Hospital, Hanoi, Vietnam with a diagnosis of functional constipation Study design The treatment trial was performed in Hanoi, Vietnam from 1/10/2013 to 31/11/2014 The Rome III guideline was used to diagnose patients with chronic functional constipation [9] According to the guideline, in the absence of organic pathology, patients must meet two or more of the following criteria: 1) Two or fewer defecations in the toilet per week 2) At least one episode of fecal incontinence per week after the acquisition of toileting skills 3) History of retentive posturing or excessive volitional stool retention 4) History of painful or hard bowel movements 5) Presence of a large fecal mass in the rectum 6) The history of large diameter stools which may obstruct the toilet Infants up to years have to fulfill ≥ of the crite- 62 ria for at least month, whereas those > years need to fulfill ≥ of the criteria for at least months and have insufficient criteria for irritable bowel syndrome A total of 140 children from ages - years old presenting with constipation based on a modification of the Rome III criteria were eligible for the trial Evaluation of treatment outcome All patients were examined, advised to change dietary, adherence to daily toilet training, used lactulose with ml/kg/day If patients have diarrhea, the dose of lactulose will decrease ml/kg/day After week of treatment, patients still defecate hard stool < times per week, lactulose will increase ml//kg/day Parents received fiber chart of common foods; the Bristol stool chart; and a stool diary to record the frequency of daily bowel movements, fecal soiling, stool consistency, as well as any symptoms they considered important The children were evaluated clinically at study entry and at 4, and 12 weeks after enrollment Treatment responses were assessed by evaluation of the daily stool diary Treatment compliance was assessed by direct interview with the patient, checking the diary cards (on which the number of daily capsules taken was recorded), and counting the capsules returned by the patient at each visit Statistical analysis Statistical analysis was performed using the computer software SPSS 16.0 Student’s t test was used to compare means of continuous variables approximating a normal distribution The x² test or Fisher’s exact test was used, as appropriate, to compare percentages A p-value < 0.05 was JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH considered statistically significant III RESULTS Ethics Baseline characteristics of study groups From 1/10/2013 to 31/11/2014, 140 children presenting with constipation were enrolled in the study This study was approved by the Science Council of Hanoi Medical University A written informed consent was signed by children’s parents/ caretakers before participating in the present study Table Baseline characteristics Age (months) 35,9 ± 17,4 Gender Boys (%) 51.8 Girls (%) 43.2 Disease duration (months) 11 ± 9.7 Mean weekly stool frequency 1,9 ± 0,8 Stool consistency (%) Type 77.9 Type 22.2 Patients with painful bowel movements (%) 80.7 Patients with anal fissure (%) 54.3 Patients with a fecal mass in the rectum (%) 66,4 The beneficial effects of lactulose with ml/kg/day in the treatment of chronic functional constipationin children Figure shows the mean stool frequency increased from 1.9 ± 0.8 stools/ week at baseline to 4.9 ± 1.8 at weeks and 5.9 ± 1.4 at the end of the study (p < 0.01) Fingure Change in the weekly stool frequency JMR 111 E2 (2) - 2018 63 JOURNAL OF MEDICAL RESEARCH The successful treatment rate (defined as weekly stool frequency ≥ times and fecal incontinence ≤ time every weeks) was 68% after weeks and increased to 72.8% after and 12 weeks of treatment Table Change in stool consistency during treatment Stool consistency (%) Type Type Type Type Baseline 78.6 21.4 0 weeks 9.7 49.5 40.8 weeks 2.9 30.1 67 12 weeks 0 14.6 85.4 p-value < 0.01 < 0.01 Stool consistency : Type – Separate hard lumps, like nuts; Type – Sausage – shaped, but lumpy; Type – Like a sausage but with cracks on its surface; Type – Like a sausage or snake, smooth and soft The percentage of patients used 2ml of lactulose/ kg/ day after weeks of treatment was 87.4% This rate decreased to 80.6% (after weeks) and 75.5% after 12 weeks (Table 2) Table Change in dose of lactulose from baseline to after 12 weeks At weeks At weeks At 12 weeks Dose n % n % n % ml/kg/day 11 10.7 14 13.6 17 16.5 ml/kg/day 90 87.4 83 80.6 78 75.7 ml/kg/day 1.9 5.8 6.8 Time Amount of water and fiber/ day affect to treatment Table shows a difference in the mean weekly stool frequency between fiber intake per day > 80% and ≤ 80% standard recommended after weeks, weeks and 12 weeks of treatment with p value.Children with fiber intake per day ≤ 80% standard recommendation had increased risk for hard stools (type - 3) compared to > 80% group at weeks and weeks (p < 0.05) Table 4: Amount of fiber/day affect to mean weekly stool frequency Time At weeks 64 Amount of fiber n (%) X ± SD ≤ 80% 49 (47.6) 4.4 ± 1.8 > 80% 54 (52.4) 5.2 ± 1.8 p value 0.03 JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH At weeks At 12 weeks ≤ 80% 35 (34) 4.7 ± 1.7 > 80% 68 (66) 5.5 ± 1.5 ≤ 80% 11 (10.7) 5.5 ± 1.9 > 80% 92 (89.3) ± 1.3 0.02 0.30 IV DISCUSSION Based on recommendations from NASPGHAN and ESPGHAN, we chose a daily intake of mean dose of lactulose (2 ml/kg/ day) in this study The results showed that the frequency and consistency of defecation and other clinical symptoms as painful bowel movements, anal fissure, fecal incontinence, blood in stool improved significantly (p < 0.05) In this study, we used different doses of lactulose to evaluate the effects of lactulose in the treatment of functional constipation The effective dose of lactulose was changeable based on factors such as diet, adherence to treatment, duration of constipation and any previous used medications Banaszkiewicz’ trial used lactulose with ml/ kg/day, which showed that the mean weekly stool frequency improved, as did our study [4] According to Sadeghzadeh's study, the frequency of defecation per week increased from 0.8 ± 0.8 to 1.5 ± 0.98 times (in the lactulose group) and from 1.7 ± 0.8 to 2.1 ± 0.7 times (in the lactulose plus protease group) after weeks of treatment [5] The improvement of frequency of defecation in this study was slower than our results In one study conducted by Wang, 111 patients over years of age received lactulose with 15 ml/kg, the median stool frequency following week of treatment inJMR 111 E2 (2) - 2018 creased to from to times per week, and following weeks of treatment increased to times per week Prior to treatment, the stool consistencies of all enrolled patients ranged from type to on the Bristol Stool Scale Lactulose treatment also improved the stool consistency to 3.64 ± 1.33 following week of treatment and 3.63 ± 1.33 following weeks [7] In our study, almost 70% of children with constipation were successfully treated after weeks of treatment This rate increased up to 72.8% after weeks The lactulose dose of ml/kg/day is appropriate for children with constipation After weeks of treatment, almost all patients maintained the dose of ml/kg/day; only 10.7% of them reduced the dose (1 ml/kg/day) due to diarrhea, and a few had to be increased due to unresponsive treatment (1.9%) The success rate in our study was higher than Voskuijl’s study after weeks of treatment (29%) In Voskuijl’s study, the mean lactulose dose associated with improvement were 11.52 (4.56) g/day (1.9 sachets) and 13.86 (6.66) g/day (2.3 sachets) at and weeks The optimal dose of lactulose in clinically successful patients < years and ≥ years was 0.96 (0.45) g/kg/day and 0.45 (0.27) g/kg/day, respectively [8] According to Wang, the effective rate of treatment was 65 JOURNAL OF MEDICAL RESEARCH 39.64% after week and increased 41.44% after weeks of treatment [7] Limited water and fiber intake per day as risk factors for constipation have been shown in many studies The results of our study showed that fiber intake per day ≤ 80% standard recommendation affected the effect of lactulose in improving the frequency and consistency of defecation and clinical symptoms Dietary fiber is good for treating constipation, but the role of additional fiber in improving the effect of constipation treatment is not yet approved In Kokke, and Loening-Baucke's clinical trials, there was no significant improvement in bowel movements after fiber therapy compared with placebo and traditional treatments such as lactulose (Duphalac) [10; 11] The strength of our study lies in the large sample size for a pediatric trial, a compliance rate of 73,6%, and a follow-up A weakness of the study was the difficulty of conducting a randomized double-blind trial over a wide weight range, as would be unethical having control groups allowing more optimal dosing V CONCLUSION Lactulose is a safe, effective and well-tolerated long-term treatment for constipation Regular supplement of fiber and fluid over 80%, according to standard recommendation for constipated children is important to improve the effect in the treatment of constipation Acknowledgments We would like to thank the doctors and staff at the Gastrointestinal department at 66 the National Children Hospital in Hanoi, Vietnam for their assistance We also wish to thank all children and their parents who participated in the study for their precious collaborative spirit REFERENCES Van den Berg MM, Benninga MA, Di Lorenzo C (2006) Epidemiology of childhood constipation: a systematic review American Journal of Gastroenterology, 101, 2401 - 2409 Vandenplas Y, De Greef E, Devreker T et al (2013).Probiotics and prebiotics in infants and children Current Infectious Disease Reports, 15(3), 251 - 262 Tabbers MM, DiLorenzo C, Berger MY, et al (2014) Evaluation and treatment of functional constipation in infants and children: evidence-based recommendations from ESPGHAN and NASPGHAN Journal of Pediatric Gastroenterology and Nutrition, 58, 258 - 274 Banaszkiewicz A, Szajewska H (2005) Ineffectiveness of Lactobacillus GG as an adjunct to lactulose for the treatment of constipation in children: a double - blind, placebo – controlled randomized trial The Journal of Pediatrics, 146(3), 364 - 369 Sadeghzadeh M, Rabieefar A, Khoshnevisasl P, et al (2014) The effect of probiotics on childhood constipation: randomized controlled double blind clinical trial International Journal Pediatric, 937212 Rowan-Legg A (2011) Managing functional constipation in children Paediatric Child Health, 16(10), 661 – 670 Wang Y, Wang B, Jiang X et al (2012) Polyethylene glycol 4000 treatment JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH for children with constipation: A randomized comparative multicenter study Experimental and Therapeutic Medicine, 3(5), 853 856 Voskuijl W, de Lorijn F, Verwijs W, et al (2004) PEG 3350 (Transipeg) versus lactulose in the treatment of childhood functional constipation: a double blind, randomized, controlled, multicenter trial Gut 53(11), 1590 - 1594 Rome Foundation (2006) Guidelines Rome III Diagnostic Criteria for Functional Gastrointestinal Disorders Journal of JMR 111 E2 (2) - 2018 Gastrointestinal and Liver Disease, 15(3), 307 - 312 10 Loening-Baucke V (2007) Prevalence rates for constipation and faecal and urinary incontinence Archives of Disease in Childhood, 92(6), 486 - 489 11 Kokke FT, Scholtens PA, Alles MS, et al (2009) A dietary fiber mixture versus lactulose in the treatment of childhood constipation: a double blind randomized controlled trial Journal of Pediatric Gastroenterology and Nutrition, 47(5), 592 - 597 67 JOURNAL OF MEDICAL RESEARCH CORRELATING OF THE VISUAL FIELD INDEX WITH MEAN DEVIATION AND PATTERN STANDARD DEVIATION IN GLAUCOMA PATIENTS Bui Thi Huong Giang, Pham Thi Kim Thanh Department of Ophthamology , Hanoi Medical University The purpose of our study was to evaluate the correlation between the new index - visual field index (VFI) and mean deviation index (MD) and pattern standard deviation (PSD) in patients with glaucoma MD, PSD and VFI were calculated in data about 103 eyes obtained from a cross-sectional study in 103 eyes of 58 patients with mild to severe glaucoma or ocular hypertension The correlation of VFI to MD, PSD was evaluated with linear regression models, and the coefficient of determination (r) was calculated The result showed that the average values of VFI, MD and PSD were 78.76%, -10.22 dB and 4.56 dB respectively The VFI and the MD were linearly correlated with r = 0.984 For the patients with VFIs below 90%, the correlation with the MD was better than for the patients with VFIs 90% and above (r = 0.986 vs 0.571) There was no statistically significant difference in VFI value between the group with cataract and the group without cataract (p > 0.05) but MD varied significantly between these two groups (p < 0.05) For the PSD, the correlation for the patients with VFIs 90% and above was greater than for the patients with VFIs below 90% (r = -0.982 vs -0.196) In conclusion, VFI was linearly correlated with MD and PSD VFI seems to be less affected by cataract than MD Keywords: VFI, MD, PSD, visual field I INTRODUCTION In management of glaucoma patients, the visual field (VF) is the most important new index, introduced by Bengtsson B and Heijl A in 2008 [4] The VFI expresses the tool to determine the stage and progression of the disease [1] VF data is summarized in global summary indices [2] At this time, the mean deviation index (MD) and the pattern standard deviation (PSD) are the standard indices to evaluate for glaucomatous damage [3] The Visual Field Index (VFI) is a visual function as a percentage of normal age-corrected sensitivity Therefore, the VFI of an eye with a completely normal visual field is 100% and the VFI of a perimetrically blind eye is 0% The VFI was designed using the Humphrey 30 - and 24 - test point patterns, which are the most commonly used patterns in glaucoma management [3] To avoid effects of cataract on the VFI, the pattern deviation probability map was used to identify test points with normal sensitivity (100%), having absolute defect (0%), and Corresponding author: Bui Thi Huong Giang, Department of Ophthamology, Hanoi Medical University Email: buihuonggiang@hmu.edu.vn Received: 03 June 2017 Accepted: 16 November 2017 68 JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH those demonstrating relative loss The sensitivity at these points were scored using the following formula: 100 - [(total deviationI/age-corrected normal threshold) x 100] , where |total deviation| is the absolute value of the numerical total deviation value and age-corrected normal threshold is intercept - age coefficient x patient age The VFI was also constructed to weigh the central points of the visual field more heavily than peripheral points The VFI is the mean of all weighed scores in percent The test point pattern was divided into five concentric rings of increasing eccentricity Cortical magnification of any given visual field location is assumed to reflect both ganglion cell density and the number of neurons in an area of the visual cortex responsible for processing a stimulus of a given size [5] The weights of the test points decreased with increasing eccentricity from 3.29, 1.28, 0.79, and 0.57 to 0.45 at the outermost ring The VFI is automatically computed using in the current ‘‘Statpac software’’ of the Humphrey Field Analyzer (HFA II; Carl Zeiss Meditec, Inc., Dublin, California, USA) (Fig.1) [4] Figure Visual field of a glaucoma patient Mean Deviation (MD) is the average of JMR 111 E2 (2) - 2018 these deviations across all test locations Mean defect expresses the difference between observed and expected mean sensitivity MD expresses the overall reduction in sensitivity, and is therefore decreased not only by increasing glaucoma, but also by cataract [6] Pattern standard deviation (PSD), a depiction of focal defects, measures irregularity between the threshold value for each point and the average visual field sensitivity at each point Thus, in patients with severely damaged visual fields the value of PSD is too low to be useful as an indicator of severity of disease [7] Glaucoma is an ocular disease, in which characteristic visual field loss corresponds to the underlying anatomic arrangement of damaged retinal ganglion cells Glaucomatous visual field characterized by loss is localized defects [8] To stage glaucoma, most classification systems use MD, PSD, and the number of defective points in the visual field test However, the MD is affected by both glaucoma and media opacities Thus, cataract or media opacities can falsely inflate glaucoma severity Bengtsson B and Heijl A used the pattern deviation probability maps in the visual field test to make the VFI test as resistant as possible to the effects of media opacities, while clearly depicting localized loss [4] There are many studies concerning the VFI in the world [9;10] The relationship between VFI and other visual field indices has not been studied in Vietnam The objective of this study was to evaluate the correlation between VFI and other visual field indices (MD, PSD) in glaucoma patients 69 JOURNAL OF MEDICAL RESEARCH II SUBJECTS AND METHODS Subjects Glaucoma patients who agreed to participate were examined Patients performed the 24 - threshold test (Humphrey SITA standard) The VF tests with reliability indices (Fixation losses, False positives, False negatives) > 20% were excluded Inclusion criteria included a clinical diagnosis of primary glaucoma or ocular hypertension and absence of other retinal disease They had a best corrected visual acuity (VA) equal to or better than 20/60 and refractive error within ± 5.00 D sphere and ± 3.00 D astigmatism Methods This cross-sectional study was performed between December 2015 and April 2016 at Glaucoma department, Vietnam National Institute of Ophthalmology To calculate the sample size of this crosssectional study, we assumed that the rate of visual field loss in glaucoma patients was 85% [6] The following formula was used: N = [(Z 1-α/2)2 p.q] / d2 To achieve 95% confidence intervals (CIs) and 7% error, 103 eyes from 58 patients were examined The MD was calculated as the weighted mean of the total deviation values, and the weight assigned to each location was the inverse of the variance in the healthy reference group The PSD was determined by comparing the differences between adjacent points [2] The VFI was calculated as described by Bengtsson and Heijl At each location, the measured sensitivity was expressed as a percentage of the sensitivity expected in a healthy observer of the same age, and the VFI was calculated as the weighted mean of all locations with pattern deviation probability outside normal limits (< 5%) [11] The relationship between VFI, MD, and PSD was described with linear regression analysis VFI was treated as the dependent variable; MD and PSD were treated as independent variables in all regressions To evaluate the relationship between variables from a single patient, the correlation coefficient (r) was calculated by SPSS 20.0 Statistics Ethics Research subjects were informed about the goals of the study and voluntarily agreed to participate The study was approved by Vietnam National Institute of Ophthalmology III RESULTS A total of 77 eyes with glaucoma and 26 eyes with ocular hypertension were studied The VFI ranged from 100% (normal visual field) to 1% The MD showed the overall depression ranged from - 33.56 dB to - 0.93 dB PSD ranged from 1.03 to 13.35 dB 70 JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH Table Average visual field indices Average ± SD Min - max VFI (%) MD (dB) PSD (dB) 78.76 ± 28.75 - 10.22 ± 8.71 4.56 ± 3.45 – 100 (- 33.56) – (- 0.93) 1.03 – 13.35 Chart Comparison of MD and VFI Correlation coefficient (r) is 0.984 The two tailed P value is < 0.0001 In single visual fields, there was a close relationship between MD and VFI A significant correlation between MD and VFI was shown in all eyes (r = 0.984, P < 0.0001) which was positive linear This relationship was described by the equation: VFI = 111.4 + 3.2 x MD (%) This model predicts VFIs of 92%, 73%, and 47% for visual fields with MDs of − 6, − 12, and − 20 dB, with prediction intervals of approximately ± 8% Chart Comparison of PSD and VFI Correlation coefficient(r) is -0.667 The two tailed P value is < 0.0001 Chart showed the linear regression between VFI and PSD with r = - 0.667, p < 0.0001 JMR 111 E2 (2) - 2018 71 JOURNAL OF MEDICAL RESEARCH Table The correlation between VFI and MD, PSD in the patients with VFI ≥ 90% and VFI < 90% VFI (≥ 90%) - MD VFI (< 90%) - MD VFI (≥ 90%) - PSD VFI (< 90%) - PSD p < 0.001 < 0.01 < 0.001 > 0.05 R 0.986 0.571 - 0.982 - 0.196 The VFI was more closely correlated with MD than it was with PSD PSD was significantly correlated observations of VFI ≥ 90%, but not with observations where VFI < 90% Table MD and VFI average patients without glaucomatous defects in visual field test Cataract VF index MD (dB) VFI (%) No cataract - 3.22 ± 1.28 (26) 98.73 ± 0.96 (26) Cataract - 5.34 ± 2.63 (12) 98.83 ± 0.72 (12) 0.014 0.09 p In 50 eyes with MD > - 6dB, 38 eyes had no glaucomatous defects in visual field test (stage – classification Hodapp, Parish and Anderson - 1993) [12] We compare the average MD and average VFI between the group with cataract and the group without cataract There was no significant difference in the VFI between two the groups (p > 0.05) but was significant difference in the MD between two the groups (p < 0.05) IV DISCUSSION Global indices of VFs have always played an important role in summarizing the severity of glaucoma MD and PSD are the two most popular global indices used in clinical practice However, both of them have limitations MD is affected by media opacities and by other causes of generalized depression of visual function in addition to glaucoma PSD is less affected by media opacities, but has the disadvantage that it falsely improves as the severity of VF loss increases VFI was meant to address some of the limitations of MD and PSD [13] The results of our study show that a linear regression between VFI and MD, and PSD 72 with the correlation coefficient is 0.984 and -0.667 The increase in the variability of MD observed in damaged visual fields is consistent with previous reports [13,14] Our analysis suggests also an equation for estimating VFI from MD In this study, we compared the MD and the VFI in the patients without glaucomatous defects in visual field test So that, MD decreased only by cataract or by media opacities There was no statistical difference in the VFI between group with cataract and group without cataract These findings are similar to those of previous studies on visual fields [15,16] This result demonstrated that JMR 111 E2 (2) - 2018 JOURNAL OF MEDICAL RESEARCH VFI seems less affected by cataract than MD Bengtsson B and Heijl A used the pattern deviation probability maps of the standard Statpac program of the Humphrey perimeter to make the VFI as resistant as possible to the effects of media opacities They realized that MDI is only very weakly center weighted, and therefore is not as well correlated to patient visual function as may be desired [4] The pattern deviation concept has been widely accepted and applied to perimetric analysis and is used as a way of reducing the effects of developing cataract The pattern deviation was only used as a tool for identifying abnormal test points The extent of the field loss at those locations, then, is based on total deviation values In addition, locations in the center of the visual field are more heavily weighted and therefore make a greater contribution to the VFI than those in the periphery [4,15,17] For the patients with VFIs 90% and above, the correlation with the MD and with the PSD was better than for the patients with VFIs below 90% (r = 0.986 vs 0.571) The stronger correlation of higher VFI values with higher MD may reflect differing patterns of local and diffuse VF loss of glaucoma In group with VFI below 90%, the patients had more severe glaucoma These eyes were often accompanied by cataract (due to intraocular hyertension) The MD on these eyes were higher than the “true value” reflecting the glaucoma stage due to MD that reflect localized defects of glaucoma but also reflects diffuse defects due to cataract While the VFI only reflects localized defects due to glaucoma [15] This explains that JMR 111 E2 (2) - 2018 the correlation between MD and VFI is less strict This result confirmed that VFI seems less affected by media opacities V CONCLUSION In conclusion , VFI had linear correlation with both MD and with PSD This correlation was stronger in patients with high VFI values VFI seems to be less affected by cataract than MD Our study suggest that VFI may become a useful and simple tool for accurately determining glaucomatous visual field defects, especially in patients that have both glaucoma and cetaracts Acknowlegements We would like to express our sincere thanks to the doctors and medical staff at the Glaucoma department at Vietnam National Institute of Ophthalmology for their support during this study REFERENCES Paul N Shacknow andJohn R Samples (2010), The Glaucoma Book: a practical, evidence-based approach to patient care, chủ biên, Springer Science & Business Media, 253 - 257 Heijl A, Lindgren G, Olsson Jet al (1992), "On weighted visual field indices", Graefes Arch Clin Exp Ophthalmo 230, 397 – 400 Advanced Glaucoma Intervention Study (1994), Visual field test scoring and reliability, ed, Vol 101, Ophthalmology Bengtsson B andHeijl A (2008), "A visual field index for calculation of glaucoma rate of progression", Am J Ophthalmol 145, 343 – 353 73 JOURNAL OF MEDICAL RESEARCH Levi DM, Klein SA andAitsebaomo AP (1985), "Vernier acuity, crowding, and cortical magnification", Vision Res 25, 963 - 977 Racette L, Medeiros FA, Zangwill LMet al (2008), "Diagnostic Accuracy of the Maxtrix 24-2 and Original N-30 Frequency Doubling Technology Test Compared with Standard Automated Perimetry", Invest Ophthalmol Vis Sci 49(3), 954 - 960 Weijland A, Fankhauser F, Bebie Het al (2004), Automated perimetry, visual field digest., 5th ed, ed, Switzerland: HaagStreit AG Yousefi S, Goldbaum MH andBalasubramanian M (2014), "Learning From Data: Recognizing Glaucomatous Defect Patterns and Detecting Progression From Visual Field Measurements", IEEE transactions on bio-medical engineering 61(7), 2112 - 2124 Remo Susanna Jr andRoberto M Vessani (2009), "University of São Paulo Glaucoma Visual Field Staging System (USP-GVFSS): A New Way to Stage Visual Field in Glaucoma", Investigative Ophthalmology & Visual Science 50, 5287 10 Lee JM, Cirineo N, Ramanathan Met al (2014), "Performance of the visual field index in glaucoma patients with moderately advanced visual field loss", Am J Ophthalmology 157(1), 39 - 43 11 Bengtsson B, Patella VM andHeijl 74 A (2009), "Prediction of glaucomatous visual field loss by extra polation of linear trends", Arch Ophthalmol 127, 1610 – 1615 12 Hodapp E, Parrish RK andAnderson DR (1993), Clinical decisions in glaucoma, St Louis, Mosby 13 Gazala Mansuri, Arpan Chawala, Saurin Gandhiet al (2014), "Relationship of a new visual field index, the VFI, with Mean deviation (MD) in 30-2 and 24-2 threshold tests examined by Humphrey field analyzer in POAG patients", Gujarat Medical Journal 69(1), 93 - 95 14 Paul H Artes, Neil O'Leary, Donna M Hutchisonet al (2011), "Properties of the Statpac Visual Field Index", Invest Ophthalmol Vis Sci 52(7), 4030 - 4038 15 Leon Nehmad andKrishna Morar (2009), "Investigating the association of the visual field index with mean deviation and pattern standard deviation in glaucoma patients", American Academy of Optometry 16 Rao H.L., Kumar A.U., Babu J.G.et al (2013), "Effect of cataract extraction on Visual Field Index in glaucoma", J Glaucoma 22(2), 164 - 168 17 Soliman MA, de Jong LA, Ismaeil AAet al (2002), "Standard achromatic perimetry, short wavelength automated perimetry, and frequency doubling technology for detection of glaucoma damage", Ophthalmology 109, 444 – 454 JMR 111 E2 (2) - 2018 ... Kit (Lytech, Russia) Realtime - PCR technique was used to identify polymorphism of CYP2C19 gene (CYP2C19* 2 , CYP2C19* 3) and ITGB3 gene (PlA1 / PlA2) The primers used for PCR of each polymorphism... possibilities for applying this technique as a routine test before indications of clopidogrel and aspirin therapy for PCI patients The aim of this study was to investigate the frequencies of CYP2C19. .. while we focused on CYP2C19* 2, CYP2C19* 3 and PlA2 as the most important alleles responsible for the resistance to clopidogrel and aspirin therapy, we did not study the prevalence of other non-functional