the propagation velocity of a water wave

... signal or the output of an actual switch Such signals can be used to label the brain signals and to evaluate the performance of a BI The data analysis of individuals with motor disabilities was ... event-related potentials by means of fast wavelet transform Brain Lang 1999, 66:129-145 Samar VJ, Bopardikar A, Rao R, Swartz K: Wavelet analysis of neuroelectric waveforms: A conceptual tutorial Brain ... "details" at different frequency bands and a coarser representation of the signal called an "approximation" For our study, the rbio3.3 wavelet from the B-spline family was chosen as the wavelet...

Ngày tải lên: 19/06/2014, 10:20

... hPa and -1.5 MPa was considered as ’plant-available’ The water content directly after a saturating infiltration is taken as the ’saturated water content’ &s; of the humus material This thetas ... throughfall and stand microclimatological data as well as the humus moisture content at a weekly interval as input data After solving the water balance equation, the resulting term is taken as the water ... characteristics) They allow the calculation of the saturating water content &s; (i.e thetas the water content immediately after a saturating infiltration) and the water retention capacity &r; (i.e the difference...

Ngày tải lên: 09/08/2014, 04:20

... Propagation of simulated action potentials (APs) in a single linear chain of 100 myocardial cells Figure Propagation of simulated action potentials (APs) in a single linear chain of 100 myocardial ... study of cardiac muscle using PSpice provides the ability to change the electrical equivalence of physiological parameters A simulation study by PSpice can be made as accurate as using the mathematical ... Table Thus, increasing the number of gjchannels has a great effect on propagation velocity, Table 5: Summary of data showing the effect of the number of gjchannels on the length constant (λ) and...

Ngày tải lên: 13/08/2014, 16:21

... At stable beating, wave elevation plots of the wave tank show that the surface profiles change with a periodicity corresponding to the beat period The velocity vector plots in CFD, as well as ... contributions are very small At this Uc/Um ratio, waves are observed to be diffracting significantly at the measured wake location, to the extent that wave frequency peak is prevailing in the transverse velocity ... the centreline of the upstream cylinder location, the presence of the downstream cylinder will enhance the asymmetric features of the wake flow velocities and temporal variations of the surface...

Ngày tải lên: 10/09/2015, 15:54

... collinear wave current flows, and waves and currents in opposite directions, while Figure shows the schematic of the SPAR and TAD arrangement and the direction of the current and wave flows Collinear ... the kinematics of the other To quantify the dominance of either currents or waves in the wave current field on a cylinder, the ratio of the current flow (Uc) to the maximum particle (Uw) in the ... and is known as the Kelvin wake The wave crests arising from a body travelling at a speed V has a local phase celerity cf of: 𝑐𝑓 = 𝜔 𝑘 = 𝑉 𝑐𝑜𝑠𝜃 (1.6) θ is the angle that the wave component makes...

Ngày tải lên: 10/09/2015, 15:54

... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 321 Plots of Kinematics in the Wake of Upstream Cylinder ... velocities measured at y = 0.6 D offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 322 Plots of Kinematics in the Wake of Upstream Cylinder ... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 75 mm/s 323 Plots of Kinematics in the Wake of Upstream Cylinder...

Ngày tải lên: 10/09/2015, 15:54

... increment at steady state beating Wave only, T = 0.7 s run Downstream cylinder placed at x = ½ D, y = 373 Appendix H Iso Surface Plots of Numerical Wave Tank Figure H1 Iso surface plots of wave and ... surface plots of wave and currents run, C =50mm/s, T =0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H6 Iso surface plots of wave and ... surface plots of wave and currents run, C =75mm/s, T =0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0) Figure H11 Iso surface plots of wave and...

Ngày tải lên: 10/09/2015, 15:54

... a nGaAs/p-GaAs doped superlattice, a Ga As/Ga As Al cylindrical quantum wire and a a Ga As/Ga As Al rectangular quantum wire show that α depends strongly and nonlinearly on the intensity E0 and ... in a quantum well, we will evaluate, plot, and discuss the expression of the nonlinear absorption coefficient for the case of a specific quantum well: AlAs/GaAs/AlAs The parameters used in the calculations ... on the electromagnetic wave energy at different values of the radius of wire It is seen that α has the same maximum values (peaks) at Ω ≡ ω The electromagnetic wave energy at which α has a maximum...

Ngày tải lên: 22/11/2015, 20:01

... a l c u l a t io n a n d d is c u s s io n F ig u r e Dependence o f the absorption coefficient of E M W on the energy o f E M W and temperature in the case of the Absence o f a M ag n e tic ... a l m a g n e tic fie ld fo r a ty p ic a l q u a n tu m w ir e G a A s / G a A s A l w it h values: n = 0.01m eV;m = 0.067m ,e = 2.07e0 ; r = A ° a n d th e sy s te m is a s su m e d to be a ... o f the absorption coefficient o f E M W on the energy o f E M W and radius in the case o f the presence o f a M agnetic Fie ld NguyenQuctngBau,DinhQuocVuong 10 B a s e d o n t h e a n a ly...

Ngày tải lên: 14/12/2017, 14:44

... to a bulk electron gas, in this section, we numerically evaluate the analytic formulae in Eqs (14-18) for a compensated n-GaAs/p-GaAs DSL The characteristic parameters of the GaAs layer of the ... as the EWM is high frequency ωτ >> 1, the resonant regions of the absorption coefficient appear when the values of G(ω) are greater There is one more resonant peak of α xx (ω ) and the values of ... peak of G (ω ) in the region of the values of N from N=5 to N=20 on the number of periods axis but the values of G (ω ) with case of confined phonons are much larger than their values with the...

Ngày tải lên: 15/12/2017, 15:51

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

Ngày tải lên: 24/12/2013, 01:17

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... active site of the enzyme by reducing the occupied internal volume, allowing the introduction of an extra water molecule [29] Replacement of the same residue by Ala similarly maintains the same...

Ngày tải lên: 21/02/2014, 01:21

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...

Ngày tải lên: 08/03/2014, 22:20

... phosphate This occurred in the absence of CoA Taking into account the reaction mechanism of mammalian ACL [23], the final step of the reaction can be assumed to be the nucleophilic attack of CoA to ... effect of ADP As an increased ratio of ADP towards ATP significantly inhibits Cl-ACL activity, we investigated the effect of ADP on the phosphorylation of AclA Addition of 10–100 lM ADP to the phosphorylated ... be assistance of the nucleotide binding to and phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA...

Ngày tải lên: 08/03/2014, 22:20