the number of successes as a random variable

... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...

Ngày tải lên: 17/02/2014, 19:20

... visual impairment rates and indicators of other eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor ... were available During the 1999 national census a filtering survey called "Everyday Life and Health" was added A total of 2,275 geographical areas were picked at random from the 1990 survey, stratified ... explaining the prevalence rate differences across the regions Unfortunately, such aspects of ophthalmological activity or quality estimates are unavailable in France at a regional level Lastly, the...

Ngày tải lên: 20/06/2014, 15:20

... of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; and a commercial ... always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the men who have made ... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has...

Ngày tải lên: 28/06/2014, 17:21

... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has ... living—when they can get the work Their incomes are mainly from serial publication in the different magazines; and the prosperity of the magazines has given a whole class existence which, as a class, was ... right along," as the English boys at Oxford made an American collegian say in a theme which they imagined for him in his national parlance; and the man of letters, as an artist, is apt to have...

Ngày tải lên: 28/06/2014, 17:21

... deal of attention to stable balance of payments situations The main aim of this paper is to examine the monetary approach to the balance of payments (MABP), which argues that the balance of payments ... whether the series are stationary Table above summarizes the results for all the variables The results show that all the variables are non-stationary at levels since the calculated tau values are ... 1972 The monetary approach to balance of payments theory Journal of financial and quantitative analysis, 7:1555–1572 Laffer, AB 1969 The US balance of payments – A financial center view Law and...

Ngày tải lên: 13/07/2014, 21:13

... and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs and Mathematical Tables, Dover Publications, New York, 1966 [2] E .A Bender, Central and Local Limit Theorems Applied ... uniformly for all real numbers x Our result follows since, apart from the error term, the smallest term in (29) has order of magnitude at least n−m−1 for x2 = x2 (n) ≤ ln n As a consequence of Theorem ... ≤ ln n and m is a fixed integer at least 2 Here, H2q are the Hermite polynomials defined before Theorem and the S2q are defined in Theorem In particular, we have a complete asymptotic expansion...

Ngày tải lên: 07/08/2014, 06:20

... probability, has t(k) ∼ (k/2)2 References [1] Alon, N., and Friedgut, E (1999) On the number of permutations avoiding a given pattern J Combinatorial Theory, Ser A, to appear [2] B´na, M (1997) Exact and ... Consider the concatenation τ of τ with τ as a permutation, τ ∈ Sm+n Clearly, τ avoids σ, establishing (2) [In detail, suppose to the contrary that τ contains σ, say at the k-tuple of positions given ... is an integer! For the special class of “layered patterns,” such as σ = 67 345 12, B´na [3] has shown that supn F (n, σ)1/n is finite Alon and Friedgut o [1] prove an upper bound for the general...

Ngày tải lên: 07/08/2014, 06:22

... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then ... the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers...

Ngày tải lên: 07/08/2014, 06:22

... C4 contains v ∗ as a vertex, we must have that every w ∈ A appears in at least one of A or A+ (it may appear in both; in particular, v ∗ appears in both A and A+ as there are no antiparallel ... Hence, A ∪ A+ = A Thus, at least one of them has cardinality at least m/2 Assume, without loss of generality, that |A+ | ≥ m/2 (otherwise we can reverse the directions of all edges and the result ... be an Eulerian bipartite digraph We may assume that G does not contain antiparallel edges, since otherwise G has a directed cycle of length and we are done the electronic journal of combinatorics...

Ngày tải lên: 07/08/2014, 06:23

... Several parts of the proofs are computer aided, both for searching the strong words (the main concept in the proofs) as well as for checking their compatibilities We have included the Mathematica ... 1011001110110001001110110010111 Table 3: The set of strong words of length at least 25 preceding the word p = 01001100010011 Notice that as starting letters and are not symmetric, because of the chosen p Also, there are ... h(rzrz) is a factor of h(w) We obtain a contradiction as above ˆ On the other hand, if |y| < 28, then |x′ | ≥ by (6) A suffix x′ = x of any block with length at least four determines the block uniquely...

Ngày tải lên: 08/08/2014, 12:23

... and Analytic Theory, Pure and Applied Mathematics, vol 278, Chapman & Hall/CRC, 2006 [15] A Geroldinger, Additive group theory and non-unique factorizations, Combinatorial Number Theory and Additive ... Math 37 (2007), 1541– 1550 [12] W.D Gao, A Geroldinger and Q.H Wang, A quantitative aspect of non-unique factorizations: the Narkiewicz constants, International Journal of Number Theory, to appear ... subsequences, all of which are pairwise disjoint, implies that |S| is bounded as in the case of Theorem 11 for cyclic groups In general, we have the following theorem Theorem 15 For any finite abelian group...

Ngày tải lên: 08/08/2014, 14:23

... that ketamine was the cause of the patient's complaints, as the timing of the onset of symptoms correlated strongly with the commencement of ketamine use In addition, the evidence shows our case ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table ... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy...

Ngày tải lên: 11/08/2014, 21:22

... estimate the sparsity of a sparse random sequence and (ii) to estimate the sparsity of a large sparse covariance matrix Here, loosely speaking, sparsity is interpreted as the proportion of parameters ... Covariance selection 13 In Chapter of this thesis, we aim at estimating the sparsity of the population covariance matrix If the sparsity of the population covariance matrix can be well estimated, ... estimate covariance matrices from a Bayes perspective The idea is to specify an appropriate prior for the population covariance matrix and choose a (shrinkage) estimator based on a particular loss...

Ngày tải lên: 09/09/2015, 18:53

... effort has been taken to verify the accuracy of this information, neither The Economist Intelligence Unit Ltd nor the sponsor of this report can accept any responsibility or liability for reliance ... “Boardroom risk in a changing economic climate—Executive Summary”; 《经 济学人》会议，2015年9月2日 http://www.goldmansachs.com/gsam/glm/insights/market-insights/china-bondmarket/china-bond-market.pdf © The ... 1301 Cityplaza Four 12 Taikoo Wan Road Taikoo Shing Hong Kong Tel: (852) 2585 3888 Fax: (852) 2802 7638 E-mail: hongkong@eiu.com Geneva Boulevard des Tranchées 16 1206 Geneva Switzerland Tel: (41)...

Ngày tải lên: 06/12/2015, 23:04

... #N28 3 The Tutte polynomial and increasing trees A spanning tree in Kn with root at is said to be increasing whenever its vertices increase along the paths away from the root A 0–1–2 increasing ... invA be the number of inversions in A The inversion enumerator Jn (y) is then defined as the generating function of spanning trees arranged by number of inversions, that is, y invA , Jn (y) = A ... is an increasing tree where all the vertices have at most edges going out A remarkable result stated in [4] and proved in [5] (see also a bijective proof in [3]) is that an equals the number of...

Ngày tải lên: 07/08/2014, 15:22

... in the class of maximal K3,3 -minor-free graphs and we can use the number of planar graphs and the number of triangulations as lower bounds Determining the number (of graphs of sub-classes) of ... singularity analysis to obtain asymptotic estimates for the number (and properties) of the graphs in these classes The last section contains + + the enumeration of graphs not containing K3,3 as a ... classes can be obtained by considering (maximal) planar graphs Due to Kuratowski’s theorem [10] planar graphs are K3,3 - and K5 -minorfree Hence, the class of (maximal) planar graphs is contained...

Ngày tải lên: 07/08/2014, 21:20

... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... cusp Let a1 ≤ a2 ≤ · · · ≤ an−1 be the successive minima (in the sense of √ Minkowski) of OL Then one has automatically a1 a2 an−1 DL ; however, on account of the assumption that K has no proper ... is reasonable to ask about the distribution of [L], as L varies, in the finite volume space S Hendrik Lenstra has informed us that David Terr has proven the equidistribution of a closely related...

Ngày tải lên: 06/03/2014, 08:21

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...

Ngày tải lên: 07/03/2014, 15:20

... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...

Ngày tải lên: 18/03/2014, 01:20

... interviewing nurse assessed the patients' nutritional status and symptoms of other potential problematic areas At discharge, the patients' dependency on a walking aid and gait capacity was measured in ... further research [17] The aim of the present study was to evaluate the effectiveness of an ICP in patients with an acute fracture of the hip The main outcome measure was the length of hospital ... path may start a positive chain reaction that can be kept going An example is the earliest first ambulation that was planned either on the day of surgery or the next morning Thus, the aim was...

Ngày tải lên: 20/06/2014, 00:20