the native language of a computer consist of

Ngày tải lên: 02/04/2014, 13:20

Ngày tải lên: 12/07/2014, 06:00

Ngày tải lên: 27/07/2014, 15:21

Ngày tải lên: 07/08/2014, 15:22

Ngày tải lên: 10/08/2014, 10:23

Ngày tải lên: 18/06/2014, 19:20

Ngày tải lên: 21/06/2014, 20:20

... that the agr feature of the DAG associated with the VP be the same as (unified with) the agr of the V. Thus, the VP's agr feature will have as its value the same node as the V's agr, ... label/value pairs, where the values are themselves DAGs (either atomic or complex). Two labels can have the same value thus the use of the term graph rather than tree. DAGs are notated either ... with associated DAGs. The right side of the rule lists the cat values of the DAGs associated with the filial constituents; the left side, the eat of the parent The associated uni- fications specify...

Ngày tải lên: 24/03/2014, 01:21

... factors : the dispersal of infor- mation and the obscurity of the coding. In ARIANE-78, the lexical data base may reside on much more 50 files, for a given pair of language. This data base ... always done by the translator. THAM consists of a set of functions programmed in the macro language associated with a powerful text editor. These functions help the translator and improve his ... part of another file, make permutations or transpositions of several parts of a file, and receive suggestions for the translation of a word displayed in a win- dow. Moreover, the system can...

Ngày tải lên: 17/03/2014, 19:21

Ngày tải lên: 30/03/2015, 14:34

... [18]. The biophysical characteri- zation of SPRK did not reveal the classical cold adap- ted features [19], but still initial comparative studies showed that the catalytic turnover was at least ... SPRK also has an aspar- tic acid residue at position at 200, and with the same conformation as in the two other structures, but Asp200 forms a salt bridge to Lys253 (Ala253 and Asn250 in PRK and ... reported. Results and discussion Crystallization, data collection and refinement Crystals of the catalytic domain of the Serratia prote- inase K (SPRK) grew within a few days to thin hexa- gonal plates growing...

Ngày tải lên: 19/02/2014, 07:20

... system. Also, their underlying task (air travel domain) is much simpler than our tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual ... Spoken Dialogue Performance Analy- sis. In Proc. of EMNLP. M. Walker, D. Litman, C. Kamm and A. Abella. 2000. Towards Developing General Models of Usability with PARADISE. Natural Language Engineering. ... hints/de- scribes the answer, each discourse segment has an additional purpose annotation that is displayed when the segment is part of the visible horizon. Auto-collapse. To reduce the amount of infor- mation...

Ngày tải lên: 20/02/2014, 12:20

... Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability group. ―Size‖ is the natural logarithm of market capitalization at fiscal year-end. ... sample, we again use proprietary data obtained through SAM. Panel A of Table 3 presents a comparison between the High and Low Sustainability firms across several data items that relate to actions ... Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability group. ―Size‖ is the natural logarithm of market capitalization at the end of 2009....

Ngày tải lên: 06/03/2014, 20:21

... superficial treatment of language 278 References Almuhareb, A. and Poesio, M. (2004). Attribute-Based and Value-Based Clustering: An Evaluation. In Proc. of EMNLP 2004. Barcelona. Almuhareb, A. and ... Savant Our retrieval goals in IR are often affective in na- ture: we want to find a way of speaking about a topic that expresses a particular sentiment and car- ries a certain tone. However, affective ... cake. They also har- vest 8934 attribute nouns, such as temperature and color, using the query the * of the C is|was”. These values and attributes are then used as the basis of a clustering algorithm...

Ngày tải lên: 07/03/2014, 22:20

... B=MIC B ị=n where A and B are the MICs of drug A and drug B in the combination, MIC A and MIC B are the MICs of drug A and drug B alone, FIC A and FIC B are the FICs of drug A and drug B and n is the number of ... purchased from Avanti Polar Lipids (Alabaster, AL, USA). FITC-Ds were purchased from Sigma. All other chemicals were reagent grade. For antimicrobial assays, the commercially available quality ... & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains. Antimicrob Agents Chemother 52,...

Ngày tải lên: 16/03/2014, 00:20

... (Stratagene, La Jolla, CA, USA). The primers used were: 5Â-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 Â (forward, the mutagenesis codon underlined) and 5Â-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3Â ... of degradative enzymes, such as the alkaline protease aprE, at the tran- scriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/). A ... characterized over the past decades in a variety of organisms, from bacteria to the eukaryote Saccharomyces cerevisiae [1,2]. More recently, the existence of a salvage pathway for the synthesis of thiamin...

Ngày tải lên: 16/03/2014, 00:20

... Institute of Instrumentation Frontier, National Institute of Advanced Industrial Science and Technology, Ibaraki, Japan Post-translational phosphorylation serves as a control mechanism in a myriad of ... study reveals that both tau peptides are capable of self-aggregation and that phosphorylation at Ser356 can modulate this process. Abbreviations AD, Alzheimer’s disease; PHF, paired helical lament; ... which predominantly carries a double negative charge at neutral pH, affects the electrostatic potential and quite often the conformation of the modified protein. Even in the absence of rearrangement, the change in...

Ngày tải lên: 16/03/2014, 05:20

... the Frank Kingdom of Jerusalem. The occupation by the fair-haired peoples of the Baltic and North Seas of the lands of Turk and Tartar, of Syrian and Jew, of Armenian and Mesopotamian, was never a ... of a question and appreciate the point of view of the other man. What Lever pointed out during the early stages of the Franco-German war has come to pass. The Standard of forty years ago is the ... Sea" in the other case. The sin of German militarism was at last out. It could take to the water as kindly as to the land. As long as the war machine guaranteed the inviolability of German...

Ngày tải lên: 17/03/2014, 13:20

... discs about the same size and shape as our own galaxy. They appear elliptical because most of them are viewed at a slant, and of course they are faint because they are so far away. The idea of a ... Wright's theory of the Milky Way, Kant in 1755 in his Universal Natural History and Theory of the Heavens sug- gested that the nebulae 'or rather a species of them' are really circular ... Hubble's work had to stop. With the advent after the war of larger telescopes at Palomar and Mount Hamilton, Hubble's programme was taken up again by other astronomers (notably Allan Sandage...

Ngày tải lên: 17/03/2014, 13:35

... I saw there, grosso modo, a neo-Kantian adaptation of the grand ‘‘magic words’’ of Vasarian academicism: triumphant ri- nascita ` recast in a certain notion of the history of art as rationalist humanism; ... renounce the humanism of the history of art: death. Resemblance as drama. Two medieval treatises facing Vasari: the rent subject facing the man of humanism. The history of art is a history of imbroglios ... for the German theoretical vocabu- lary (he was horrified, for example, by the fact that the word taktisch can mean both ‘‘tactical’’ and ‘‘tactile’’). 25 As a man alert to the dangers of unreason—which...

Ngày tải lên: 18/03/2014, 09:15