the major parts of a business letter

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...

13
596
2

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx

Danh mục: Anh văn thương mại

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

7
475
0

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf

Danh mục: Anh văn thương mại

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

7
574
1

anon - 1807 - remarks and experiments on different parts of the process of brewing; particularly on the continued application of a boiling heat during the operation of mashing

Danh mục: Hóa học - Dầu khí

...

68
333
0

Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

Danh mục: Báo cáo khoa học

... guage [48] Data were loaded into a MySQL database for subsequent querying Additional data files The following additional data are available with the online version of this paper Additional data ... the pair that has the smallest Ks among all of the gene pairs that share the same parental genes The number of retrogenes in human in this study is approximately the same as that reported by Marques ... [19] also indicated that tandemly arrayed genes (TAGs) account for about 20% of all genes in mammals Because TAGs are among the primary products of unequal crossover [20], it appears likely that...

11
357
0

Danh mục: Báo cáo khoa học

... genes in various databases Proportion of homologues of ORFs from annotated IEs in the core genes database, the viral database, the plasmid database and the annotated IE database, as well as the proportion ... Number of identified CAGs, CAG size distribution and proportion of already annotated IEs (a) Average number and standard deviations of CAGs in the different analyzed groups of Archaea and Bacteria ... results and wrote the paper All authors read and approved the final manuscript Detection of ORFans All ORFs in the 119 analyzed genomes were searched by BLASTP against the nr database at the NCBI (as...

13
244
0

The Marketing Strategy of a multinational join stock company.doc

Danh mục: Quản trị kinh doanh

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... and the theory that will be later based on to research The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one Gaining ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

25
623
8

Layout of a formal letter

Danh mục: Tiếng anh

... on organising it in a clear and logical manner rather than expanding too much Last Paragraph The last paragraph of a formal letter should state what action you expect the recipient to take- to ... Formal Letter First paragraph The first paragraph should be short and state the purpose of the letter- to make an enquiry, complain, request something, etc The paragraph or paragraphs in the ... Letter of Enquiry A letter of enquiry is when you are approaching a company speculatively, that is you are making an approach without their having advertised or announced a vacancy Opening Paragraph...

7
635
1

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Danh mục: Kỹ thuật lập trình

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

6
428
0

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Danh mục: Báo cáo khoa học

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...

8
494
0

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Deﬁnition" pptx

Danh mục: Báo cáo khoa học

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

5
585
0

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Danh mục: Báo cáo khoa học

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The ﬁnal concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

12
740
0

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Danh mục: Báo cáo khoa học

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the ﬁrst factor was found to be the major ... that in the presence of the substrate, rotation of Asp142 towards Glu144 lowers the pKa of the latter by 0.8 pH units The calculated effects of the D140N and D215N mutations varied drastically...

10
651
0

Danh mục: Báo cáo khoa học

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially ﬂattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial ﬂattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

8
528
0

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Danh mục: Báo cáo khoa học

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be reﬁned to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

6
387
0

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Danh mục: Báo cáo khoa học

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Puriﬁcation, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulﬁde-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then reﬁned smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The ﬁnal model has a ﬁnal R-factor of 0.222 with a...

9
533
0

Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Danh mục: Báo cáo khoa học

... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...

8
551
0

Báo cáo "The linguitic Situation of a Hmong Community in the North - West of Vietnam " pdf

Danh mục: Báo cáo khoa học

...

9
372
0