the human rights system as a constitutionalized regime of international law
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx
... CXCL10 AST/Mat AST IL-12 p35 IL-12 p40 0.02 Mat Control AST/Mat AST Mat 0.00 Control AST/Mat AST Mat Control 0.05 1.0 0.8 0.015 0.01 0.010 AST/Mat AST 0.000 Mat AST/Mat AST Mat 0.00 Control AST/Mat ... using the highly sensitive Limulus assay indicated only trace reactivity for the purified human material and none for the recombinant peptide Matrigel angiogenesis assay The assay was performed as ... Folkman J: Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis Proc Natl Acad Sci USA 2003, 100:4736-4741 Chavakis T, Athanasopoulos...
- 8
- 477
- 0
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx
... possible to investigate human language equally systematically and on an equally grand scale: a Human Linguome Project, as it were, though we have chosen the Human Language Project” as a more inviting ... purposes a perfectly adequate meaning representation That is, we view machine translation as an approximation to language understanding Here is another way to put it One measure of adequacy of a language ... can turn the size of the task—constructing MT systems for all the world’s languages simultaneously—to one’s advantage, and thereby consume dramatically less data per language One of the greatest...
- 10
- 574
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
- 8
- 426
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade...
- 11
- 419
- 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... obtained was used as a template for real-time quantitative polymerase chain reaction, which was performed with the LC FastStart DNA Master SYBR GreenI® (Roche Diagnostics, Mannheim, Germany) in a LightCycler® ... 2:116-126 20 Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3 antibody A synergistic effect mediated by the VLA-5 fibronectin ... receptors and are activated by lipopolysaccharide J Exp Med 2003, 197:403-411 Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kitamura T, Kosugi A, Kimoto M, Miyake K: Essential role of...
- 14
- 505
- 0
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative signaling ... d-siRNAs that resulted in an absolute value of the CAsH score ≥0.95 (see Additional data file for the list of primary hits and Figure S4 in Additional data file for the distribution of the CAsH ... signaling pathway (b) Quantification of the effects of different siRNAs targeting the PtdIns(3,4,5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean...
- 11
- 286
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of...
- 6
- 578
- 0
The human rights creed in four schools
... display the hallmarks of the school I associate them with The hallmarks of the natural school are that human rights are conceived as entitlements and that human rights law is regarded favourably ... by means of the law as well as by means of a wider culture that sustains and motivates the law .133 As far as he is concerned, it cannot be assumed that ‘universal capital or universal human right ... progress of human rights since 1948’112 chimes with the fact that natural scholars conceive of human rights law as a direct continuation of human rights It has been said that the lawyers are ‘the...
- 40
- 308
- 0
Tài liệu The reform of the civil service system as Viet Nam moves into the middle income country category doc
... with the right job-related knowledge, skills and educational level, as well as the adoption of performance appraisal There is greater emphasis on management according to law and accountability has ... while offering them legal protection against arbitrary and incompetent officials and the mass media The cost of the civil service as streamlined and measures were taken to decrease the use of indirect ... professional standards and norms and encouraging a sense of accountability and transparency in activities related to citizens Another aim was to reform the salary system to ensure that the salaries of...
- 40
- 684
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per ... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... allocated for the provision of obstetric anesthesia services The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants of obstetric anesthesia...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
... release of ROS from NADPH oxidase and mitochondria, sustained increase of the cytosolic Ca2+ concentration and finally nuclear translocation of mitogen-activated protein kinase kinase ⁄ extracellular ... currently available PARP-1 activation and cell death in the neurovascular unit Poly(ADP-ribose) polymerases (PARPs) are NADdependent enzymes that are able to catalyse the transfer of ADP-ribose ... histological basis Also, careful and rigorous selection of patients with salvageable tissue [evidenced using magnetic resonance imaging as the presence of an area of hypoperfusion larger than that of altered...
- 10
- 417
- 0
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc
... [28–30] As a means of quality assurance, we analyzed the proteins by liquid chromatography-coupled (LC-MS) and native MS The measured masses obtained by LC-MS are depicted in Table Using the denaturing ... results Stoichiometry (native ESI-MS) Average mass calculated (Da)b Mass measured LC-ESI-MS Mass measured ESI-MS (native) (Da) a W15-peptide TQAKRKKSLAMA [30] ine c As previously measured [31] b R77L ... times (1 h), revealed no major other cleavage products (data not shown) Addition of cGMP had a remarkable effect on the stability of the R77L mutant Now, a rather rapid degradation was observed (Fig...
- 13
- 440
- 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... the influence of human cyt b5 changes dramatically as the cyt b5/P450c17 ratio varies Effect of P450red on DHEA and androstadienol synthesis To further investigate the modulation of human P450c17 ... enzymatic assays using human and porcine P450c17 in the presence of various substrates – preg, 17aOHpreg and DHEA – and analyzed androstadienol formation from each substrate As observed in Fig 3, the ... biosynthesis of androstadienol in humans (A) and pigs (B) does not require prior formation of 1 7a- OH-preg and DHEA The lack of androstadienol synthesis in the presence of lM of ketoconazole (C), an...
- 7
- 612
- 0
The human rights impacts of oil palm plantation expansion in Indonesia pot
... Thanks in West Kalimantan to Shaban Setiawan and all the staff at WALHI KalBar, Vincentius V., AMA (Aliansi Masyarakat Adat) KalBar, Adrianus Amit, Pemberdayaan Otonomi Rakyat (POR), John Bamba ... staff at Yayasan Elang, WALHI Riau, Kelompok Advokasi Riau, Aliansi Masyarakat Adat Riau (AMAR), Hakiki, Santo Kurniawan at Jikalahari Thanks to all the numerous other individuals and organisations ... p.IV-34, Laporan Akhir, Keterpaduan Kebijakan Antar Sektor dalam Peningkatan Daya Saing Kawasan Andalan dan Percepatan Pembangunan Daerah Tertinggal, Direktorat Kewilayahan II Kementerian Negara Perencanaan...
- 108
- 583
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...
- 10
- 396
- 0
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf
... its head, with the property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial ft~%ctional-equation ... to the fact that using LFG as syntactic base for IRT - and not the categorial syntax of Kamp - the ~raveling of the thematic relations in a sentence is already accomplished in f-structure Therefore ... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For...
- 6
- 476
- 0
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... GLAST, EAAC1 and of GCPII in the rat peripheral nervous system J Anat 2008, 213:539-546 Cassidy M, Neale JH: N-acetylaspartylglutamate catabolism is achieved by an enzyme on the cell surface of...
- 8
- 406
- 0
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... GLAST, EAAC1 and of GCPII in the rat peripheral nervous system J Anat 2008, 213:539-546 Cassidy M, Neale JH: N-acetylaspartylglutamate catabolism is achieved by an enzyme on the cell surface of...
- 8
- 304
- 0
Báo cáo hóa học: " Research Article Robust Object Categorization and Segmentation Motivated by Visual Contexts in the Human Visual System" docx
... in the car codebook and in airplane codebook have a similar appearance At the same time, each category also has a contextually related background codebook Therefore, each category has a category-specific ... Visual Context in Human Visual System 2.1 Part-Part Context According to Gestalt’s law, the human visual system actively utilizes the laws of proximity and similarity to discriminate the figural ... and appearance parameter for bottom-up inference The learning process is quite simple As shown in Figure 20, initially we have a set of CCBs, such as a car, or an airplane The appearance parameter...
- 22
- 321
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25