... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
Ngày tải lên: 05/03/2014, 17:20
... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... on a shaker at °C, the solutions were withdrawn from each cell The zinc concentration of the solutions was measured by ICP-AES The data were analyzed using prism software (GraphPad Software, San...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...
Ngày tải lên: 23/03/2014, 05:22
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
Ngày tải lên: 28/03/2014, 20:20
A Portrait of the Artist as a Young Man ppt
... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed ... would be dark and sleeping There was cold night air in the chapel and the marbles were the colour the sea was at night The sea was cold day 16 A Portrait of the Artist as a Young Man and night: ... had big voices and big boots and they studied trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again...
Ngày tải lên: 31/03/2014, 14:20
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the ... was a landscape consisting of mountains, meadows, sky and clouds The floor was the distance from the subject's eyes to the virtual floor and the nearest column was 4.6 m away The resolution of...
Ngày tải lên: 19/06/2014, 10:20
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... canvas shoe factories and similar works Even the production of such essentially native goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the ... commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé to Bahia Blanca—in some cases there being not even firm sand—and as dredging...
Ngày tải lên: 28/06/2014, 19:20
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... the measurement of serum ferritin in the assessment of microcytic anaemia (ferritin), the measurement of serum follicle stimulating hormone (FSH) in the assessment of menopausal status, and the...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... Endometriomas appear homogeneously hyperintense on T1-weighted sequences [10] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... program for MATLAB software (Natick, MA, USA) by an orthopedic researcher who was blinded to the treatment groups The average of the disc height index (DHI) was calculated as a ratio of the average ... COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene expression analyses Nine rabbits were euthanized weeks after either Link N or saline injection, and ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...
Ngày tải lên: 12/08/2014, 17:22
DETERMINATION OF THE APPROPRIATE CONTENT OF CALCIUM NITRITE AS A CORROSION INHIBITOR IN REINFORCED CONCRETE docx
... very fast under the effect of chloride ion in marine environment Cua Cam port The strongly agressivity rate of chloride ion is the main reason causing corrosion, especially in the tropical climate ... 1.Extract of cement water Reinforced concrete samples Material and research methodology Extract of cement water Reference extract of cement water (H0) Extract of Cement water with ClExtract of Cement ... corroded • The extract containing Cl-: corrosion rate is continuously increased with the time and with Clratios • At [Cl-]/[NO2-] 2,2; corrosion rate was very small Research results Case of reinforced...
Ngày tải lên: 13/08/2014, 22:21
Báo cáo y học: "Genomic studies of mood disorders - the brain as a muscle" pot
... pharmacotherapy and psychotherapy, with a treadmill supplanting the proverbial Freudian couch The Romans may have had it right with their ideal of mens sana in corpore sano (a healthy mind in a ... Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and serum of schizophrenic patients Mol ... state and leaves open the possibility that the opposite may be true that FGFs may be increased - in more manic states, giving an overall mixed picture in brains from bipolar patients As a caveat,...
Ngày tải lên: 14/08/2014, 14:21
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation...
Ngày tải lên: 15/05/2015, 00:37
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... research questions are also clearly stated to act the parameter for the whole paper I.1 RATIONALE A vast body of research has studied writing portfolios as a form of assessment tool or in terms of ... reasons for choosing the topic, objectives, scope, tasks and significance of the study, the research method as well as an overview of the thesis Chapter two, Theoretical background, lays the theoretical...
Ngày tải lên: 16/07/2015, 07:45
The Stockmarket as a Sourc of Finance
... profitabilityrather than increased cash flow One solutionproposed by Fazzari et al (1988) isto use the q ratio as a measure of the expectedprofitability and cash flows as a measure of the availability of funds ... acceleratortheoryemphasizesoutput as the principaldeterminantof capital expenditures,neoclassicaltheory emphasizescost of capital,modifiedneoclassicaltheoryemphasizescost of capital and output, cash flow theory ... though the information-theoreticapproach assumes the prevalence of capital market constraints and financing hierarchy, it is cast in a neoclassical framework with the usual assumption that managers...
Ngày tải lên: 22/04/2016, 07:45
Advertising and the internet a study of agency client expectations of the internet as a promotional tool
... -: "### ( ( ! + & - A " - " " -3 @ & 144$ 1" A + ! : !8) ! )8 )89 8? This figure is not available online Please consult the hardcopy thesis available from the QUT Library T A T & " 1; ! -3 & @ ... 8? This figure is not available online Please consult the hardcopy thesis available from the QUT Library T A T "" -3 ! & @ -!-!- & & 144$ CG ! ( $ ( -% - "+ 144H ( ! & A ( ( G# !9+ 1C & -% > ... ( D "4 1#D + O 1#C ! ( D G# ) ( O 1#$ ! ( D G1 ) ( O 1#H : %! =A A * )8% A "1 ! & 1G A "" ! A "G + A D1 & ( % 1D DC ( H5 A D" 5# A DG ( 55 + = @!)=/ +! =@ & ' ( ! )** ! - "!0 ) & 14$5 1DD $ *1...
Ngày tải lên: 07/08/2017, 12:37
The Vietnamese agenda of adopting english as a medium of instruction
... late 20th and early 21st century, such as membership in ASEAN (the Association of South East Asian Nations) in July 1995, the US removal of the trade embargo against Vietnam in 1994, officially becoming ... EMI was introduced into educational institutions with a more complicated agenda Take the case of the International Standard Program (ISP) at Vietnam National University as an example The overall ... identity and national language policy National identity, articulated by national language policy, has been seen as one of the contributing factors for increasing and diverse EMI practices in Asian...
Ngày tải lên: 07/12/2017, 10:20