the first law of thermodynamics is a restatement of the quizlet

Ngày tải lên: 21/06/2014, 00:20

... constant  PV )( 1 1 )()( 2211221121 VPVPVPVP R C TTnCW V V              1 2 0 ln V V nRTWQ 4/29/2008 2 Chapter XV The First Law of Thermodynamics §1. Heat, work and paths of a thermodynamic process §2. The first law of thermodynamics §3. Kinds of thermodynamic processes §4. Thermodynamic processes ... processes for an ideal gas 4/29/2008 26 Summary  The first law of thermodynamics: ΔU = Q - W The change of internal energy The quantity of heat added to the system The work done by the system  The work ... Calculation of work done during volume changes:  A typical example of a thermodynamic system is an amount of gas enclosed in a cylinder with a movable piston. (Such a system is the central part...

Ngày tải lên: 17/01/2014, 04:20

... oligo- merization domain (i.e. b sheets 7 and 8, the AAA domain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA ... domain helix and the C-terminal helix, but not the b domain. The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which dif- fers from that of other AAA ATPases ... material is available online: Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species. This material is available as part of the online article from...

Ngày tải lên: 07/03/2014, 05:20

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... cerato-platanin domain, and a blastp search always yielded the members of the cera- to-platanin family as the best hits. It is possible that they represent an ancestral cerato-platanin member that is ... confrontation assays, osmotic stress and starva- tion. Although the TrichoEST database comprises ESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H. jecorina is available,...

Ngày tải lên: 07/03/2014, 12:20

Ngày tải lên: 22/03/2014, 17:20

Ngày tải lên: 23/03/2014, 12:20

Ngày tải lên: 31/03/2014, 01:20

Ngày tải lên: 04/06/2014, 12:23

Ngày tải lên: 13/07/2014, 23:26

... situations. To mask some of the noise at low light levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard. Some cameras that automatically ... scene have the same color temperature. A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation. Most cameras can adjust automatically to ... near the subject and pointed toward the camera. The minimum acceptable level for color television depends on the ability of the lens to transmit light to the camera, the sensitivity of the...

Ngày tải lên: 26/01/2014, 04:20

... raɪz nju ː w ɜːdz and grammatical rules. In fact, learning English can be a piece of cake. ənd ɡrə ˈmæt ɪk əl ru ːlz ɪn fækt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ kæn bi ː ə pi ːs ʌv keɪk Don’t worry about ... worry about pronunciation. Don’t worry about grammar. doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən. doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes. Just try to speak. doʊnt bi ː ə ... want to improve my English! Many people are worried about learning English. ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ ˈɪŋ ɡlɪʃ They think English is difficult and it’s hard to memorize new...

Ngày tải lên: 27/01/2014, 20:11

... Tom is an international speaker and anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorfor TaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtax strategies. ... industry was born called nancial planners. Today it takes 30 days to become a nancial planner. It still takes a year and a half to become a massage therapist. Robert Andy,whatdoyouthink of mutualfunds? Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…now peopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankon that...

Ngày tải lên: 08/02/2014, 18:12

... that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the ... right along," as the English boys at Oxford made an American collegian say in a theme which they imagined for him in his national parlance; and the man of letters, as an artist, is apt to have ... necessity rather than the ideal of the paragrapher, and that the notoriety the journalists bestow upon him is not the measure of their acquaintance with his work, far less his meaning. They are good...

Ngày tải lên: 17/02/2014, 19:20

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2...

Ngày tải lên: 19/02/2014, 05:20

... evolutionary analysis of the DNase I family. The mammalian group formed a relatively tight cluster, while the snake (E. quadrivirgata, E. climacophora and A. blomhoffii), amphibian (X. laevis, Rana catesbeiana, ... quadrivirgata , E. climacophora and A. blomhoffii DNases I Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any DNA contamination was ... reagent grade and available commercially. The snakes and Japanese white rabbits were acquired, main- tained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals...

Ngày tải lên: 20/02/2014, 23:20

... es la selección de las variables antropométri- cas más adecuadas para caracterizar poblaciones sanas de personas mayores. Para ello se han seleccionado aleatoria- mente 1030 de estas personas ... nificant factors (with eigenvalues greater than unity) that are capable of explaining 94.5% of the variance and thus most of the infor mation in the original data set. The new “latent” factors are ... Chemistry. Faculty of Sciences. University of Valladolid. Valladolid. Spain. SELECCIÓN DE LAS VARIABLES ANTROPOMÉTRICAS MÁS ADECUADAS PARA CARACTERIZAR UNA POBLACIÓN DE PERSONAS MAYORES SANAS Resumen El...

Ngày tải lên: 05/03/2014, 21:20

... structures of PolIIIs-V and DnaA-I adopt a vari- ant of the so-called type II KH fold [21]. One of their major differences from classical type II KH domains is the absence of the characteristic GXXG ... The actual DNA synthesis is performed by the catalytic a- subunit (PolIIIa), which belongs to the C-family of DNA polymerases [2]. Polymerases of the C-family fall into two major groups, DnaE and ... III and interaction with the alpha subunit. Nucleic Acids Res 35, 2825–2832. 20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (2007) Structure and function of DnaA N-terminal domains:...

Ngày tải lên: 05/03/2014, 23:20