... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has ... and it was not till the Sunday editions of the great dailies arose that there was any real hope for the serial in the papers I suspect that it was the vast demand for material in their pages twelve,...
Ngày tải lên: 17/02/2014, 19:20
... of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; and a commercial ... always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the men who have made ... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has...
Ngày tải lên: 28/06/2014, 17:21
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx
... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has ... still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft! Perhaps not; and yet I would rather ... interests and tastes and principles separate us, and I feel quite sure that in writing of the Man of Letters as a Man of Business I shall attract far more readers than I should in writing of him as an...
Ngày tải lên: 28/06/2014, 17:21
the balance of payments as a monetary phenomenon
... deal of attention to stable balance of payments situations The main aim of this paper is to examine the monetary approach to the balance of payments (MABP), which argues that the balance of payments ... 1972 The monetary approach to balance of payments theory Journal of financial and quantitative analysis, 7:1555–1572 Laffer, AB 1969 The US balance of payments – A financial center view Law and ... whether the series are stationary Table above summarizes the results for all the variables The results show that all the variables are non-stationary at levels since the calculated tau values are...
Ngày tải lên: 13/07/2014, 21:13
Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot
... that ketamine was the cause of the patient's complaints, as the timing of the onset of symptoms correlated strongly with the commencement of ketamine use In addition, the evidence shows our case ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table ... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy...
Ngày tải lên: 11/08/2014, 21:22
A delicate stage the future of renminbi as a global investment currency chinese
... effort has been taken to verify the accuracy of this information, neither The Economist Intelligence Unit Ltd nor the sponsor of this report can accept any responsibility or liability for reliance ... “Boardroom risk in a changing economic climate—Executive Summary”; 《经 济学人》会议,2015年9月2日 http://www.goldmansachs.com/gsam/glm/insights/market-insights/china-bondmarket/china-bond-market.pdf © The ... 1301 Cityplaza Four 12 Taikoo Wan Road Taikoo Shing Hong Kong Tel: (852) 2585 3888 Fax: (852) 2802 7638 E-mail: hongkong@eiu.com Geneva Boulevard des Tranchées 16 1206 Geneva Switzerland Tel: (41)...
Ngày tải lên: 06/12/2015, 23:04
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... Subdivisions of Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... phonology of languages Universal alphabets Logical relations of the parts of speech The vocabulary and the grammar of languages Distinctions between languages and dialects Mixed languages and jargons...
Ngày tải lên: 13/02/2014, 05:20
the emergence of a scientific culture science and the shaping of modernity 1210-1685 feb 2007
... next great task of science as the creation of a new religion.⁶ By 1931, the science columnist John Langdon-Davies was taking up the defence of the moral values of science with an attack on the use ... unification of science and the unification of the German state as being indissolubly linked, and nearly a century later Dewey was talking of the unity of science in political terms as a bulwark against ... Attraction’.¹⁰⁴ Perhaps the best-known caricature of the Royal Society, however, is the Academy of Lagado on the island of Laputa (‘whore’ in Italian) a caricature of Bacon’s New Atlantis —in Jonathan Swift’s...
Ngày tải lên: 11/06/2014, 10:28
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...
Ngày tải lên: 18/03/2014, 01:20
a study of the emergence of management accounting system ethos and its influence on perceived system success
... (TOP) At the heart of this organisational drive, was an attempt to engender greater flexibility of operational practices and an enhanced outward management orientation Many managers across the organisation ... integrating financial, operational, internal and market-based data Its reports are structured as a dynamic mix of visual, graphical, quantitative and qualitative information Financial content is ... (3.7.97) The Strategy and Marketing Manager was particularly critical of the accountants in that, according to him ‘‘PBTC calculations always better match the reality than the results from the accountants’’...
Ngày tải lên: 08/04/2014, 12:07
mathematics as a science of patterns sep 1997
... philosophy of mathematics the problem remains as acute as ever For we have a greater appreciation than previous generations of philosophers of the boundlessness of the mathematical universe and the mathematical ... philosophers of mathematics to disdain realism about mathematical objects, and to not read mathematics at face value Hartry Field has embraced an ingenious version of the view that mathematics is a useful ... as a ease of arthritis, lupus, or schizophrenia For these and a number of other diseases there are no fixed diagnostic criteria Instead the appropriate medical associations, such as the American...
Ngày tải lên: 11/06/2014, 09:52
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem ... Actually, a minor modification of the above proof shows that the assumptions of Theorem 1.1 could be weakened: the relations Rn need not be transitive if we assume the uniqueness of a point x...
Ngày tải lên: 23/06/2014, 00:20
Research for a Future in Space: The Role of Life and Physical Sciences ppt
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... dust and gasses can flow as well, as particulate materials such as sand and dust Martian soil fines are also significantly magnetic, as the Viking landers clearly demonstrated at their two landing ... that can help make long-duration spaceflight more affordable and safer Image Cred it: NASA The Matter of Materials The NASA Materials International Space Station Experiment (MISSE) mounted trays...
Ngày tải lên: 29/06/2014, 09:20
The Encyclopedia Of Nutrition And Good Health - A pdf
... In Asia, alfalfa leaves are used in the form of greens as a VEGETABLE Claims that alfalfa boosts the IMMUNE SYSTEM may relate to its trace mineral content It also has antibacterial activity, and ... mortality rate is about percent to 10 percent due to mineral imbalances The National Association of Anorexia and Associated Disorders and the American Anorexia/Bulimia Association are among the ... by the breakdown of fatty acids and the generation of NITRIC OXIDE, a free radical that functions as a localized vasodilator, a defensive chemical and as neurotransmitter Free radicals and reactive...
Ngày tải lên: 02/07/2014, 14:20
in search of memory the emergence of a new eric r kandel
... War II, was later to say that compared to Vienna, the Kristallnacht in Berlin was a pleasant Christmas festival. On the day of Kristallnacht, as my father was rounded up, his store was taken away ... and I appreciated the true meaning of Harvards alma mater, Fair Harvard. Fair Harvard, indeed! 31 The winning team at the Pennsylvania Relays, 1948 The Pennsylvania Relays is an annual national ... Kolomyya, a town of about 43,000 inhabitants on the Prut River in Galicia This region of the Austro-Hungarian Empire near Romania was then part of Poland and is now part of Ukraine Almost half the...
Ngày tải lên: 04/07/2014, 15:53
Báo cáo sinh học: "A population-based study examining the emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 in New York City" pot
... with a higher prevalence of USA300 had a greater proportion of blacks, Hispanics, females, and children, and had measures indicative of a disadvantaged socioeconomic status As more households had ... a nationwide survey examining rates of nasal colonization, S aureus was more common in men, those with asthma, and in subjects < 65 years of age; blacks and Mexicans had lower colonization rates ... prevalence Map of area) and high prevalence (gray area) for S aureus Figure strain USA3002 Map of Brooklyn indicating regions with low prevalence (white area) and high prevalence (gray area) for...
Ngày tải lên: 08/08/2014, 19:20
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
... interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and ... G, Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen associated with carotid atherosclerosis ... interpretation of data and in the revision of the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx
... subsequently the proximal by partial clamping of the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis ... beat empty of volume The last part of the operation is carried out using an off pump coronary artery bypass (OPCAB) stabilizer in order to perform the necessary distal coronary anastomoses and ... surrounding anatomical structures such as the anterolateral papillary muscle, the lateral ventricular wall, the inferior ventricular wall, etc Gradually we remove most of the necrotic tissues around the...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx
... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF were ... defined by the Transplant Iron Score Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured ... from the date of transplant to the date of death or last known follow-up All data was censored as of July 1st 2007 The following clinical and demographic parameters were collected for statistical...
Ngày tải lên: 10/08/2014, 22:20