the cii assay in transgenic rodent studies
Báo cáo y học: "Bench-to-bedside review: The importance of the precision of the reference technique in method comparison studies – with specific reference to the measurement of cardiac output" ppsx
Ngày tải lên :
13/08/2014, 11:23
... performing the studies and analysing the data The understanding of the precision of a new device is vital prior to accepting it into clinical practice and prior to using it for significant therapeutic ... large number of studies published in which a new method of measuring cardiac output has been assessed using intermittent thermodilution (ITD) from the pulmonary artery catheter as the reference ... and the variance can range from 5% to 15% depending on the technique used The main limitation of this ± 30% cutoff, therefore, is that it relies on the fact that the precision of ITD is always the...
- 6
- 318
- 0
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx
Ngày tải lên :
21/02/2014, 20:20
... form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension is defined 4.1 The processes are independent of the ... respect to the use of articles which are very often spoken in such context In addition, these same articles not have the same meaning as they in English "Le, la, les" not always mean "the" in the d ... perspective of the questions within an analysis of the hypothesis in the cont e x t of a characterization of the "how" of the entire behavior By adapting HOPE for processing French, we furthermore...
- 5
- 609
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
Ngày tải lên :
07/03/2014, 21:20
... disrupting protein–protein interactions within PSI, or by altering the conformation of the loop His-tags were employed in a topological study of the major light harvesting chlorophyll a ⁄ b binding ... that the positively charged loop domain in the latter two constructs is accessible to trypsin on the stromal side of the membrane and that placing the tags in the loop prevents PSI-G from adopting ... distributions, the loops exhibit enough variation to leave room for altered protein–protein interactions, which may explain why the Chlamydomonas loop region is exposed to trypsin in the in vitro assay The...
- 9
- 422
- 0
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
Ngày tải lên :
16/03/2014, 11:20
... observed in the untreated cell population In order to shed light on the cause of this result, we carried out an in silico analysis by incorporating the inhibition kinetics within the existing computational ... to the inhibitor were slight, amounting to a modest reduction in amplitude and a delay in the rst oscillatory peak It is interesting to speculate on the failure of the inhibitor to eliminate the ... (B) The control rhIKK2 in vitro kinase assay with no GST-IjBa substrate The time (in minutes) on the abscissa indicates the time the reactions were stopped with trichloroacetic acid and the plot...
- 13
- 475
- 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
Ngày tải lên :
16/03/2014, 14:20
... at the C-terminus We compared the quantity of scFv intrabodies and assessed their binding activity to the WASP-EVH1 domain in the scFv gene-transfected T cells Finally, we succeeded in expressing ... 10 The third PCR products were mixed in the following combinations: 18SVH–linker and linker) 18VL, 18VH–linker and linker)18VL, 21SVH–linker and linker)21VL, 21VH–linker and linker)21VL and singlechain ... coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker...
- 14
- 493
- 0
The Society for Cinema and Media Studies’ Statement of Best Practices for Fair Use in Teaching for Film and Media Educators ppt
Ngày tải lên :
30/03/2014, 12:21
... rights, including the right to exclude others from reproducing, performing, displaying, and distributing their works The law also gives copyright owners the right to exclude others from preparing ... because it may harm the general marketability of the copyrighted works by impacting their potential sales and hindering their entry into or standing in the educational market Principle III: Derivative ... noncommercial use is non-infringing; fair use analysis requires examining all of the factors relative to the others and in view of the overall aims of U.S copyright law Further, different courts...
- 10
- 533
- 2
báo cáo hóa học: " A review of health utilities using the EQ-5D in studies of cardiovascular disease" potx
Ngày tải lên :
18/06/2014, 19:20
... exploring the distribution of scores across the five dimensions of the EQ-5D [21,23,35-46] In examining the dimension-specific burden of disease among cardiovascular studies, the trend in the distribution ... different studies in a formal meta-analysis since the main objective was to contrast studies with different features and to explain heterogeneity in the results The degree of heterogeneity between studies ... other country-specific algorithms are also available [13-18] The principle aims of this paper were: to synthesise the evidence on the validity and reliability of the EQ-5D in studies within the...
- 12
- 656
- 0
Báo cáo khoa học: "Comparative studies of the water relations and the hydraulic characteristics in Fraxinus excelsior, Acer pseudoplatanus and A. opalus trees under soil water contrasted conditions Damien Lemoinea, Jean-Paul Peltierb and Gérard" pdf
Ngày tải lên :
08/08/2014, 14:21
... different sites were selected, one in the valley of the Drac river, the other in a mountain stand in the Alps The Ks (mol s–1 MPa–1 m–1) data are means ± SD with n being the number of replicates from ... one in the valley of the Drac river, the other in a mountain stand in the Alps The experiments were conducted on leaf petioles (full symbols) and branches (empty symbols) These data are obtained ... excelsior trees growing in the valley of the Drac river The experiments were carried out in the last days of July 2000 Data are the means of ten determinations (± SD) from two trees ψwp is the predawn...
- 10
- 341
- 0
Báo cáo khoa học: "The of near-infrared reflectance spectroscopy in litter decomposition studies" doc
Ngày tải lên :
08/08/2014, 23:22
... on independent samples The minimum SECV determines the number of terms to be used The final model is then recalculated with all the samples to obtain the standard error of calibration (SEC) In ... spectra from the curve fitting process Both of these residuals are plugged back into the start of the program The same calculations are performed on the residuals to obtain the second loading and ... multiplication of the spectral variance of the data and the correlation spectrum The first loading is used to fit the training spectra based on a least square is then correlated with the chemical...
- 8
- 211
- 0
Báo cáo y học: " Study protocol for the translating research in elder care (TREC): building context through case studies in long-term care project (project two)" potx
Ngày tải lên :
11/08/2014, 05:21
... embed the emerging theory in the language that is actually used within long-term care facilities to describe knowledge use in practice, thereby aiding in the dissemination and clarity of the findings ... confirm emerging findings through interviews The process of data analysis will be repeated in month five, and the researchers will again return to the field in month six to verify their findings through ... derive key themes, and then these themes will be considered in conjunction with the findings from the other data sources Additionally, analysis will be conducted within sites and then, in order...
- 10
- 332
- 0
báo cáo khoa học: " Study protocol for the translating research in elder care (TREC): building context through case studies in long-term care project (project two)" pot
Ngày tải lên :
11/08/2014, 16:20
... embed the emerging theory in the language that is actually used within long-term care facilities to describe knowledge use in practice, thereby aiding in the dissemination and clarity of the findings ... confirm emerging findings through interviews The process of data analysis will be repeated in month five, and the researchers will again return to the field in month six to verify their findings through ... derive key themes, and then these themes will be considered in conjunction with the findings from the other data sources Additionally, analysis will be conducted within sites and then, in order...
- 10
- 330
- 0
báo cáo khoa học: " The red fluorescent protein eqFP611: application in subcellular localization studies in higher plants" doc
Ngày tải lên :
12/08/2014, 05:20
... of the red and the green fluorescence in these protoplasts confirmed the co-expression of both proteins in the same cell (Fig 3) In addition to the GFP-derived green fluores- To examine whether ... ligated into plasmid peqFP611 The 99 amino-acid long N-terminal part from KAT2 including the peroxisomal targeting signal (from amino acids to 34) is now fused in frame upstream the eqFP611 coding ... added into the tool box of red fluorescent proteins for use in plants Methods In addition, the plasmids created in the course of this work are convenient tools for the investigation of the subcellular...
- 12
- 313
- 0
Báo cáo y học: "The role of the Notch pathway in healthy and osteoarthritic articular cartilage: from experimental models to ex vivo studies" pdf
Ngày tải lên :
12/08/2014, 15:22
... ligand-receptor interaction and a cysteine rich region The intracellular domain consists of ankyrin repeats, a glutamine-rich domain and a PEST (proline, glutamate, serine, threonine) domain [14,15] The ... Notch/Jagged signaling maintains the progenitor cell state [47,48] Taken together, the results of these studies suggest that Notch/Jagged signaling promotes the maintenance of the progenitor phenotype ... recent studies have focused on the involvement of this pathway in joint pathology Several studies were interested in the interaction between Notch signaling and cartilage subpopulations [68,69] In...
- 8
- 275
- 0
Báo cáo khoa học: "Application of a zona pellucida binding assay (ZBA) in the domestic cat benefits from the use of in vitro matured oocytes" pptx
Ngày tải lên :
12/08/2014, 18:22
... below the opening of the tank for minutes and then at 13 cm for minutes and finally at 20 cm below the opening for minute, before plunging them into the liquid nitrogen The straws were thawed in ... differences in ZP binding registered However, the lack of binding to FT ZP is mainly due to the ZP and not to the spermatozoa, since fresh spermatozoa also had markedly decreased binding to FT ZP In line ... decreased binding capacity of the ZP may reside in changes of the structure of the ZP that occur during unprotected freezing and/ or thawing of the ovaries The functional ability of the ZP to bind spermatozoa...
- 7
- 299
- 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx
Ngày tải lên :
12/08/2014, 19:22
... the lower inflection point before a sustained inflation Loop B: tidal insuflation with a PEEP below the lower inflection point after a sustained inflation Loop C: PEEP higher than the lower inflection ... volumes Those investigators showed that, after RMs, PEEP set at cmH2O above the lower inflection point was more effective in maintaining gas exchange and minimizing inflammation and lung injury than ... single sustained inflation to 30 cmH2O boosted the ventilatory cycle onto the deflation limb of the pressure–volume curve (Fig 1) In other words, a RM applied in a recruitable lung increases the...
- 7
- 287
- 0
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot
Ngày tải lên :
14/08/2014, 13:22
... cloning, the SalI/SmaI goat αlac promoter fragment was linked to the CAT HincII/PstI cDNA using the two blunt restriction sites and the resulting fragment linked to the PstI/SalI goat Silencing ... co-integration by homologous recombination of the shuttle vector within the BAC insert was achieved in two out of the twenty-four colonies screened In the second step of the procedure, the cointegrates ... Since the oligonucleotides used are located in exon and of the Cyclin T1 gene, the size of the PCR product indicates that it derives from a cDNA NTg: non -transgenic mice Detection of the murine...
- 9
- 359
- 0
Factors affecting the motivation of Vietnamese technical english majors in their English studies
Ngày tải lên :
03/03/2015, 09:58
... which involves the reader and the reading material in building meaning‖ What is more, meaning of the reading materials does not reside on the printed page, nor it is only in the head of the reader ... for the teacher Since the purpose of the interview was to have an in depth understanding of the teachers‘ belief about teaching reading strategies, the individual interviews were guided by an individualized ... that happen in the classroom These events might be said to "cause" student learning in the sense that the events in the classroom lead, in the case of effective teaching, to student learning It is...
- 62
- 385
- 0
KẾT CẤU MỚI CONTROLLING THE INDOOR CLIMATE IN WIDE SPAN ENCLOSURES 4 CASE STUDIES
Ngày tải lên :
09/06/2015, 17:22
... The client embarked on a significant construction contract, comprising the removal of the existing heating system, including the steam pipework installation, asbestos insulation and heaters In ... time The building's clear height (23m) was determined by the height of the Brabazon tailfin and its clear internal span, by its wingspan Its overall internal height reaches 35m At the time the ... effectively In the early 1980's a complete re-cladding of the building was undertaken to upgrade the performance of the building envelope to comply with the Building Regulations standards of the day...
- 10
- 155
- 0
Characterization of the function of tight junction proteins in transgenic mice
Ngày tải lên :
11/09/2015, 16:04
... as skin, the linings of the peritoneum and the epidermis), cuboidal (such as the the epithelium forming the collecting duct of the kidney), and columnar (such as that lining the small intestine) ... proteins that interact with corresponding proteins on the adjacent membranes are tethered to the actin cytoskeleton via scaffolding proteins (Figure 3) The TM proteins are integrated in the plasma ... domain proteins can function as scaffolds to bring together integral, signaling and cytoskeleton proteins Some scaffolding TJ proteins lacking PDZ domains such as cingulin can also link integral...
- 173
- 400
- 0