... Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High
Sustainability group. ―Size‖ is the natural logarithm of market capitalization at fiscal year-end. ... sample, we again use proprietary data obtained through SAM. Panel Aof
Table 3 presents a comparison between the High and Low Sustainability firms across several data items
that relate to actions ...
Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability
group. ―Size‖ is the natural logarithm of market capitalization at the end of 2009....
... beliefs and rules that control the management
of the company. They also represent the institutional philosophy and the support to
the cultureof an organization. The main objective of core values ... cultural
evaluation of quantitative and qualitative research study of theory, measurement of
the CC need to be quantitative research and qualitative research should be a
combined point of view. ... view.
Although cultural evaluation ofthe quantitative research has been in a CC
dominated the direction of evaluation researchers, but some scholars, the scope of its
measurement has always...
... Library Cataloguing in Publication Data
Data available
Library of Congress Cataloging in Publication Data
Data available
Typeset by Laserwords Private Limited, Chennai, India
Printed in Great ... behaviour was tantamount to challenging the word ofa public authority and
was an unforgivable sign of disrespect and dissension, the ultimate betrayal of filial piety, of family
and clan, and, ... naturalism sought to beat the
Church of England at its own cultural game. Like the evangelicals of an earlier day, the honest
doubters and advocates of scientific naturalism demanded a truer and...
... S RNA of TULV.
GGAAAUG GCCAAGU
G-C
A- U
G-C
A- U
U -A
G G
U -A
G:U
C
A- U
U -A
337 381
(+) sense
U:G
U -A
C U
C-G
U -A
C-G
U -A
C-G
U -A
A-U
C C
A- U
C A
G
U -A
A-U
(-) sense
A C
A- U
G A
G-C
A- U
CCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt
831–855). To monitor the presence of recTULV S RNA,
RT-PCR was performed with primers RECF738
(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and
Hairpin-like ... no real match to the original cell adapted variant
and that the lower fitness ofthe recombinant virus can not
be increased by pre-passaging in cell culture. The observed
survival time of the...
... prevent.
• Data manager changes data. A malicious data manager may change the value of its data on each cache
refresh. While this is an advantage for shared memory applications, it is a serious ... temporarily allow read-only access to cached data. The locking on a page may later be changed as deemed
necessary by the data manager. [To avoid race conditions, the pager_data_provided call also ... to the default pager is identical to other external data managers, there are no fundamental
assumptions made about the nature of secondary storage. For example, the default pager may use local...
... sent
–
Imprints a unique address on the data
–
The longer the code is, the more users will be able to
share the same channel
–
Number of chips in the code
•
Determines the amount of spreading or bandwidth
Wireless ... (TDMA)
–
Divides the transmission time into several slots
–
Each user is assigned the entire frequency for the
transmission
•
For a fraction of time on a fixed, rotating basis
–
Advantages
•
Uses the bandwidth ... strength falls near the level of noise
–
Interference can take place
•
To reduce the interference of noise
–
Boost the strength ofthe signal
–
Use of filters when receiving the signal
•
Attenuation
–
A...
... lineages of
mitochondrial DNA exist among the San (‘Bushmen’) of southern Africa and
the Biaka Pygmies ofthe modern Central African Republic. About 100,000 years
ago, some of these anatomically ... that it awaits further confirmation.
8
The forest margin of Cameroun and Nigeria was the region from which
Bantu speakers gradually expanded throughout the southern half of Africa. All
Bantu languages ... at about 1000
bc, they reached the eastern edge ofthe equatorial forest in the broad area of the
great East African lakes. There they settled in well-watered valleys permitting
cultivation of...
... guest the meaning ofa word
Could you guest the sign ofa new word?
Yes, Of couse. This is 20 prefix and 14 root-word helping you improve your vocabulary.
You can guest the meaning of 14.000 ... hurl, cast)].
offer: ob-và ferre [Gồm các biến dạng fer và lat (Latin: line, bring, carry)].
insist: in-và stare [Các biến dạng c a stare là sta, stat, sti, và sist (Greek: standing, stay,
make ...
talk,
speech, speak; word)].
aspect: ad-và specere [Gồm có 2 dạng spec và spic (Latin: see, sight, look, appear, behold,
and examine)].
uncomplicated: un-, com-,và plicare [Có 11 biến dạng sau:...
... and Methods: The data obtained from all ofthe four university hospitals, and
one referral tertiary-care educational state hospital in Ankara. Antimicrobial resistance
profiles of 14,233 selected ...
Hospital setting and antibiotic policy: NARP
was initiated in Turkey in February 2003 by a central
regulation of Ministry of Health and was announced
nation-wide via official newspaper ofthe ... we have esca-
lated all antibiotic prices. The cost of antibiotics was
calculated as US dollars (USD).
Statistical Analysis: Rates in every 6 months
periods ofthe study period were analyzed...
... wise to adopt the
internal law as governing law to the contract. On the other hand, the parties can agree to
adopt a certain world law regarding international trade that can listed here as CISG
(Convention ... an
international transaction. Unless parties are assured that the coverage is available in
the amount designated, the failure ofa party to obtain insurance coverage should
not be grounds for termination of ... in an
amicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of
the International Arbitration under Chamber of Commerce and industry of...
... said: the great masses of humanity
are using the Law destructively, or partially so, and the
scales are balanced against them. Here and there, among
the masses, we find an occasional outstanding ... as the beasts ofthe field, the
birds ofthe air and the fish ofthe sea are bountifully
supplied. For any man, no matter what his station in life, to
take the stand that it is the destiny of ... that I had met my deliverer, and at the
close ofthe performance was overjoyed at his invitation to
accompany him to a nearby café. I noticed that the attention
of those in the café was drawn...
...
sophisticated information systems and data warehouses been able to manage a great deal of
data. The challenge is to capture and measure soft and qualitative information. For example, in
the book The Experience ... can wonder if the popularity of non-financial measures from an academic point of view is
accompanied by the same success from a managerial perspective. There are a few researchers
who have analysed ... conventional
methods have the advantage of being investment evaluation settings. Their major drawback of
evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim,...
... that separate columns. The default value is the TAB
character.
rowDelimiter
The character or characters that separate rows. The default value is the
CARRIAGE RETURN character.
nullExpr
A string ... table.
SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders",
ConfigurationSettings.AppSettings["Sql_ConnectString"]);
DataTable dt = new DataTable(ORDERS_TABLE); ... creating a DataTable containing the Orders table from
Northwind. The GetString( ) method in this solution is called to convert the
DataTable into a string similar to one that is generated by the...
... expectations and
the performance ofthe organization’s offerings (see e.g. Parasuraman et al., 1985 & 1988 &
1991). Another stream of research is the performance-based approach (or linear ... & Kawani, 1982). Therefore, it can be argued that the aggregate satisfaction ofthe
buying organization is a rather complex function of satisfactions of individual, from an
importance viewpoint, ... on the satisfaction ofthe customer organization as a whole or the satisfaction of certain
individuals within that organization. These are clearly two different issues, since in the context of...