technology volume 3 membranes for food applications
membrane technology volume 3 membranes for food applications
... Bacteria and Spore Removal 46 46 Contents 3. 2.1.2 3. 2.2 3. 2.2.1 3. 2.2.2 3. 2 .3 3.2 .3. 1 3. 2 .3. 2 3. 3 3. 3.1 3. 3.2 3. 3 .3 3 .3. 3.1 3. 3 .3. 2 3. 3 .3. 3 3. 3 .3. 4 3. 3.4 3. 4 Casein Micelles Separation from Whey ... Modification 37 Outlook 38 References 39 2.1 2.2 2.2.1 2.2.2 2.2 .3 2.2.4 2 .3 2 .3. 1 2 .3. 2 2 .3. 3 2 .3. 4 2 .3. 5 2.4 2.5 2.5.1 2.5.2 2.5 .3 2.6 3. 1 3. 1.1 3. 1.1.1 3. 1.1.2 3. 2 3. 2.1 3. 2.1.1 23 Milk and Dairy ... 6.1 6.1.1 6.1.2 6.2 6.2.1 6.2.2 6 .3 6.4 7.1 7.1.1 7.1.2 7.1 .3 7.1.4 7.1.5 7.2 7.2.1 7.2.2 7.2 .3 7 .3 7 .3. 1 7 .3. 1.1 7 .3. 1.2 7 .3. 2 7 .3. 2.1 7 .3. 2.2 7 .3. 3 7 .3. 3.1 7 .3. 3.2 7.4 7.4.1 Influence of MF/UF...
- 265
- 771
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... Reference WT (W3 03 1B) MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura3–1, can1–100 DQCR9 DISP DBCS1 MATa, leu2 3, 112, can1–11, qcr9D2::HIS3 MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura3–1, can1–100, ... leu2 3, 112, his3, rip1D::LEU2, qcr9D2::HIS3 MATa, ade2–1, his3–11,15, leu2 3, 112, ura3–1, can1–100, rip1D::LEU2 qcr10D1::HIS3 MATa, ade2–1, leu2 3, 112, qcr9D2::HIS3, qcr10D2::LEU2 MATa, leu2 3, 112, ... Cullin C (19 93) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae Nucleic Acids Res 21, 33 29 33 30 45 Ito H, Fukuda Y, Murata K & Kimura A (19 83) Transformation of...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt
... (2007) 36 85 36 94 ª 2007 The Authors Journal compilation ª 2007 FEBS 36 89 T J Winterburn et al N-terminal extension of IA3 Identity Residue number 11 11T 34 45 57 0.1 ± 0.1 *Q S H 30 ± 13 14 MK(H) ... peptides of the indicated length In these forms of IA3, L-norleucine (Z) was substituted for methionine NI = no inhibition at lM 36 86 FEBS Journal 274 (2007) 36 85 36 94 ª 2007 The Authors Journal compilation ... NaCl Fractions containing trimmed IA3 FEBS Journal 274 (2007) 36 85 36 94 ª 2007 The Authors Journal compilation ª 2007 FEBS 36 93 N-terminal extension of IA3 T J Winterburn et al were identified...
- 10
- 510
- 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... W3 03 1 A (WT) MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura3–1, can1–100 MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura3–1, can1–100 MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura3–1, ... can1–100, qcr8D::HIS3 MATa, ade2–1, his3–11,15, trp1–1, leu2 3, 112, ura 3 1, can1–100, qcr9D1::URA3 MATa, leu2 3, 112, his3, can 1–11, qcr9D2::HIS3 MATa, ade2–1, his3–11,15, leu2 3, 112, ura3–1, can1–100, ... ISP Core Core Qcr6p Qcr7p Qcr8p Qcr9p – 18 74 83 – – 28 30 – 50 15 42 54 23 – – 31 79 15 42 49 18 – – 26 40 33 59 53 51 26 27 – 12 50 27 45 45 – 23 33 40 Cytochrome bc1 subunit analysis of cytochrome...
- 10
- 517
- 0
Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc
... Ca2+ transients Nature 37 5, 784–787 33 Dolmetsch RE, Xu K & Lewis RS (1998) Calcium oscillations increase the efficiency and specificity of gene expression Nature 39 2, 933 – 936 ´ 34 Feijo JA, Sainhas ... transform of the yi in the usual way [45] For Fig 3, we defined a series of 1024-point equally spaced and overlapping windows of the normalized O2 data (points 1–1024, 230 –12 53, 459–1482, ., 35 35 1 36 ... data points for m ⁄ z ¼ 32 (O2) for a 30 -min span starting at 730 h 42 ± (n ¼ 7), the penultimate IBI averaged 36 ± (n ¼ 7), whereas the mean of earlier IBIs reached a plateau of 30 .9 ± 2.4 (when...
- 8
- 242
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... ⁄ 33 .1 32 .0 33 .2 15.6 0.117 ⁄ 0.077 0.04 33 .5 10.4 0. 033 ⁄ 0. 031 0.02 Stereochemical restraints r.m.s (r) ˚ Bond distances (A) 0.011 (0.021) Bond angles (°) 1.609 (1.965) ˚ Chiral centers (A3) ... Gly302-Glu3 03- Ser304-Ser305-Ser306 located at the opposite end of the barrel to the active site has weaker electron density and the temperature factors of the ˚ atoms in this segment are 31 ... Journal compilation ª 2006 FEBS Glu-A 0.15 0.02 0. 13 0.51 )0.46 )0.05 0.15 0.02 0.10 0 .32 )0. 43 )0.06 0. 63 0.44 0.52 0.18 0.56 0 .39 0.46 0.15 21 63 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding...
- 11
- 548
- 0
Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot
... YCplac 33- GAS1 or the YCplac 33- GAS1-C74S plasmid Cells were labelled for with [35 S]methionine and chased for the indicated times before being processed for immunoprecipitation with anti-Gas1p IgG 36 44 ... at 30 °C for 20 min, then pulse-labelled for with 35 0 lCi of [35 S]methionine Pulse labelling was terminated upon the addition of 40 lL of chase solution containing 0 .3% (w/v) methionine and 0 .3 ... residue S 73 For Gas1C103S, the reverse primer Oligo3 (5¢-AGCCTTC ATCGATTCGGAGTGATCTAGAGTG -3 ), partially complementary to nucleotides +288 to +31 8, and Oligo4 (5¢-CTCCGAATCGATGAAGGCTTTGAATGATGC -3 )...
- 11
- 435
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
... 4.68 4.66 0 .31 2.99 1.01 2.90 2. 83 94 48 75 38 39 1.09 ± 0. 13 0.89 ± 0. 03 1.05 ± 0.07 ND ND lmol PiÆmin)1Æmg protein)1 ± ± ± ± ± 0 .31 0.29 0.16 0.22 0.02 ± ± ± ± ± 0.05 0. 03 0.6 0. 23 0.24 1878 ... SDS-gel electrophoresis was performed as described in [32 ,] Western blot analyses were described previously [33 ] Nitrocellulose membranes (Membrane Protean BA 83, 0.2 lm from Schleicher & Schuell) ... Biochem 270) 34 Schagger, H & von Jagow, G (1991) Blue native electrophoresis ¨ for isolation of membrane protein complexes in enzymatically active form Anal Biochem 199, 2 23 231 35 Schagger,...
- 10
- 550
- 0
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... pACGTS1[C53Y]/gts1D tdh1D tdh2D tdh3D pACTDH1/tdh1D pACTDH1pr.TDH2/tdh1D pACTDH1pr.TDH3/tdh1D 5. 03 5.12 5.10 5.08 5. 03 5.01 4.58 3. 32 4.95 3. 40 2.45 ± ± ± ± ± ± ± ± ± ± ± 0.08 0.11 0.18 0. 23 0.15 0. 13 ... of gts1D(W3 03) (A), gts1D(W3 03) overexpressing the wild-type (pYXGTS1/gts1D) (B), gts1D(W3 03) overexpressing the zinc-finger-disrupted Gts1p (pYXGTS1 [C53Y]/gts1D) (C), and gts1D(W3 03) overexpressing ... K & Tsurugi, K (1999) Protein interactions of Gts1p of Saccharomyces cerevisiae 33 34 35 36 37 38 39 40 41 42 43 throughout a region similar to a cytoplasmic portion of some ATP-binding cassette...
- 10
- 410
- 0
cadaver dog handbook forensic training and tactics for the recovery of human remains
... the whistle, a conditioned reinforcer, is something the animal has learned to want (Some people use the term “primary reinforcer” for food and “secondary reinforcer” for the signal I avoid those ... trainer too!) before the performance was correct and reliable Also when a trainer uses food without a conditioned reinforcer the animal is apt to look toward the trainer for food all the time ... not extend to copying for general distribution, for promotion, for creating new works, or for resale Specific permission must be obtained in writing from CRC Press LLC for such copying Direct...
- 204
- 739
- 0
state university of new york press adorno the recovery of experience oct 2007
... as an Outbreak Attempt 94 100 106 1 13 1 13 120 127 132 135 139 139 141 147 151 159 167 167 170 175 180 185 191 195 195 200 Notes 205 References 2 23 Index 233 Acknowledgments My engagement with ... ISBN 978-0-7914-7209-5 (hardcover : alk paper) Adorno, Theodor W., 19 03 1969 I Title B3199.A34F67 2007 1 93 dc22 2006 036 599 10 For Hildy This page intentionally left blank Contents Acknowledgments ... object, only in its objectification into the moment of form does it forget how and whereby it is itself constituted” (p 1 63) .37 For Adorno, this “forgetting” is not restricted to idealist philosophies,...
- 248
- 298
- 0
differentiation of brewing yeast strains by pyrolysis
... Convention Oxford University Press, pp 30 9 31 8 Savitzky, A and Golay, M J E (1964) Smoothing and differentiation of data by simplified least squares procedures Anal Chem 36 , 1627–1 633 Schofield, ... root and vector methods used in multivariate analysis Biometrika 53, 32 5 33 8 Griffiths, P R and de Haseth, J A (1986) Fourier Transform Infrared Spectrometry John Wiley, New York Hough, J S (1957) ... Timmins and Goodacre (1997) Conditions used for each experiment involved heating the sample to 100 C for s followed by Curie-point pyrolysis at 530 C for s with a temperature rise time of 0·5 s...
- 9
- 181
- 0
báo cáo hóa học: " Recovery of visual fields in brain-lesioned patients by reaction perimetry treatment" potx
... 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Gesellschaft für Psychologie: 23 27 September; Kiel Edited by: Frey D Göttingen: Hogrefe; 1990:1 23- 124 Potthoff RD, Schmielau F: Specific ... den 37 Kongress der Deutschen Page 15 of 16 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation 2007, 4 :31 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 ... for example he performed 130 correct responses when tested after treatment, his detection rate would be 130 :35 0 = 37 .1% The improvement due to treatment in that case would be 37 .1% - 28.6% = 8.5%...
- 16
- 427
- 0
báo cáo hóa học: " Apolipoprotein E isoform-dependent dendritic recovery of hippocampal neurons following activation of innate immunity" pot
... of saline 5 23 ± 38 497 ± 36 98 ± 13 52.9 ± 5.1 40.1 ± 4.9 42.2 ± 10.4 497 ± 48 456 ± 47 80 ± 10 44.7 ± 3. 3 36 .8 ± 10.0 30 .0 ± 10.1 542 ± 36 5 13 ± 39 58 ± 8^ 44.6 ± 4.7 36 .9 ± 7.2 33 .1 ± 9.8 Total ... Science 1988, 240:622- 630 Strittmatter WJ, Roses AD: Apolipoprotein E and Alzheimer's disease Proc Natl Acad Sci 1995, 92:4725-4727 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Alberts MJ, Graffagnino ... Neurochem 2004, 89:484-4 93 Imler JL, Hoffmann JA: Toll receptors in innate immunity Trends Cell Biol 2001, 11 :30 4 -31 1 Akira S: Toll-like receptor signaling J Biol Chem 20 03, 278 :38 105 -38 108 Johnson GB,...
- 9
- 233
- 0
Báo cáo hóa học: " Recovery of divergent avian bornaviruses from cases of proventricular dilatation disease: Identification of a candidate etiologic agent" pptx
... 5'-ATGACCAGGACGAGGAGATG -3' (maps to residues 8 831 -8812 of vRNA), ABV2r, 5'-CCTGTGAATGTCTCGTTTCTG -3' (maps to residues 5754-5 733 of vRNA), and ABV3r 5-TTCTTTCAGCAACCACTGACG -3' (maps to residues 25 63- 25 43 of vRNA) ... polymerase and dATP for 10 minutes at 72°C For each product, independent transformants were prepared for standard dideoxy sequencing on an ABI3 730 sequencer (ElimBio, Hayward CA) Forward and reverse ... sequenced with M13F and M13R primers For the 3' RACE products, independent transformants from independently generated PCR products were subcloned and sequenced with M13F and M13R primers Terminal...
- 15
- 308
- 0
Báo cáo hóa học: " Blind recovery of k/n rate convolutional encoders in a noisy environment" pdf
... 0. 03 Figure C (3, 2 ,3) : Probability of detection compared with Pe For the C (3, 2 ,3) encoder, the probability of detecting the true encoder is depicted compared with the channel error probability for ... http://jwcn.eurasipjournals.com/content/2011/1/168 • C (3, 2, 3) convolutional encoder: Figure shows the probability of detecting the true encoder (Pdet) compared with Pe for 1, 10, and 50 iterations It shows that, for the C (3, 2, 3) convolutional ... Indeed, the algorithm performances are excellent: P det is close to when P e corresponds to either BERr < × 10-4 for C (3, 2 ,3) convolutional encoder or BERr < 0.67 × 10-4 for the C (3, 1,4) encoder Conclusion...
- 9
- 495
- 0
Báo cáo hóa học: " Research Article Recovery of Myocardial Kinematic Function without the Time History of External Loads" ppt
... nodal forces between ground truth and estimation (KLLS) Frame number number number number 12 number 16 number 20 Ground truth 3. 82e + 0 03 3.81e + 0 03 3.78e + 0 03 3.73e + 0 03 3.70e + 0 03 Estimated ... +3. 146e− 03 −7.855e− 03 −1.886e−02 +2.899e−02 +1 .39 4e−02 −1.118e− 03 −1.617e−02 3. 123e−02 −4.628e−02 −6. 134 e−02 −7. 639 e−02 −9.145e−02 −1.065e−01 −1.216e−01 −1 .36 6e−01 −1.517e−01 +1.771e−01 +1. 535 e−01 ... strategy Conclusion +4. 838 e+00 +4. 435 e+00 +4. 032 e+00 +3. 628e+00 +3. 225e+00 +2.822e+00 +2.419e+00 +2.016e+00 +1.613e+00 +1.209e+00 +8.063e−01 +4. 032 e−01 +0e+00 −4 .39 8e− 03 −2.575e−02 −4.71e−02 −6.845e−02...
- 9
- 334
- 0
Báo cáo hóa học: " Research Article A Sharing-Based Fragile Watermarking Method for Authentication and Self-Recovery of Image Tampering" potx
... B-frame one GOP size (kbit) 1080 36 0 180 36 00 GOP = {IBBPBBPBBPBB}, 25 frames/s, 7.5 Mbit/s video bitrate # MPEG-2 TS packets # IP packets 714 102 238 34 119 17 238 0 34 0 Table 2: Value of Eb /N0 ... IEEE Transactions on Multimedia, vol 8, no 2, pp 34 1– 35 5, 2006 [21] M Watson, “Proposal for evaluation process for forward error correction codes for DVB-IPI,” DVB IPI document TMIPI2084 edition, ... packet groups (N = 5, Ncoh = 3, Ngroup = 3) where Ppack is the probability that a packet is erased and irrespective of the channel condition Ppack = +∞ Ppack (x)p(x)dx ( 23) For large Eb /N0 , Ppack...
- 17
- 289
- 0
Báo cáo hóa học: " Research Article A Simplified Constant Modulus Algorithm for Blind Recovery of MIMO QAM and PSK Signals: A Criterion with Convergence Analysis" ppt
... side of (35 ), we obtain M gk1 According to (41), gR, = gI, (42) Then (41) can be reduced to M = 1, 2 gR,k1 + 2gR, − = (36 ) k=1 ( 43) k=1,k= M gk1 Thus = (37 ) M gR, = 3 Therefore, (36 ) and (37 ) dictate ... that is, g12 = Hence, g2 will take the form g2 = | g T T , (32 ) which results in H g1 g2 = (33 ) Therefore, (26) is reduced to J g2 = E zR,2 (n) − R g2 , (34 ) A Ikhlef and D Le Guennec T where ... Imaginary −2 −4 −4 3 −2 −1 Real −6 −6 −4 −2 (a) −4 3 −2 −1 Imaginary Imaginary −2 −4 Real −6 −6 −4 −2 (d) 4 Equalizer output −4 3 −2 −1 Real (c) Mixture −1 −2 3 −4 Real −1 −2 3 −4 (b) Source...
- 13
- 444
- 0
Báo cáo nghiên cứu khoa học: "USE OF IMMOBILIZED YEAST CELL IN ALCOHOL FERMENTATION FROM MOLASSES" ppsx
... (%) 1.5 2.0 2.5 3. 0 3. 5 1 1 Amount of immobilized yeast cell (g) 0.9905 0.9920 0.99 43 0.996 0.9970 Immobilized yield (%) 99.05 99.20 99. 43 99.65 99.70 35 .32 91 37 .0715 38 .5216 40. 532 5 41.8729 Yeast ... 09 - 2008 5.0 4 .38 4.5 Alcohol mass (g) 4.0 3. 5 3. 0 1.5 3. 99 Fr 2. 83 Im 2.5 2.0 4.05 3. 56 2.88 2.62 2.59 13 2.55 14 2.17 1.0 0.5 0.0 10 11 12 Sugar concentration (%) Figure 3. 3 Alcoholic mass ... 3. 0 3. 52 2.91 2. 93 Fr 2.55 2.5 Im 2.0 1.64 1.5 1.0 1 .38 0.82 0.5 0.0 12 24 36 48 60 72 84 96 108 Time (h) Figure 3. 4 Optimal fermentable time of free yeast and Alco3.0% Trang 95 Science & Technology...
- 10
- 336
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008