taking a photo from your phone camera

Báo cáo y học: "Recently published papers: Take your predictions with a drop of saline … and breathe deeply before turning on your phone" ppt

Ngày tải lên : 12/08/2014, 20:20

... social workers), and the average response time was a phenomenal 1.7 This figure we find particularly astounding, and reflects Australia’s resurgence as a sporting nation Of particular interest are ... completely have already introduced hardware and software upgrades that remedy the problem However, in the meantime, perhaps we should keep mobile phones and ventilators at a safe distance, or at least ... straightforward parameters that focus on drastic acute changes but also include the sensible caveat that a staff member is worried about a patient Once again experience is the key So what of the...

3
302
0

A Call from the Dark

Ngày tải lên : 06/11/2012, 16:13

... looked at him blankly Crass (Colin Sass was his real name, though nobody called him that) said nothing to me at all about having a package waiting for this guy ‘Don’t worry, I can come back,’ he said ... what was with that coat anyway? It was almost summer and I was only wearing a T-shirt Everything Robert wore was, in fact, black His tight jeans with the frayed seams, his faded Korn T-shirt and ... on a Saturday afternoon when he knew the coast was clear With Crass gone we could talk in peace Before Topps could even give me a wave a customer walked in wearing plastersplattered overalls and...

11
470
0

A visit from a pen pal

Ngày tải lên : 17/01/2013, 09:58

... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...

5
1.7K
0

Unit 1: A visit from a pen pal

Ngày tải lên : 21/06/2013, 01:27

... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...

2
1.1K
0

Unit 1: A visit from a pen pal

Ngày tải lên : 21/06/2013, 01:27

... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...

3
933
0

Unit 1_ A visit from a penpal

Ngày tải lên : 26/06/2013, 01:27

... Date: Name: _ English 9_ Unit  Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975  Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...

4
552
0

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Ngày tải lên : 05/09/2013, 10:15

... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...

9
522
0

unit 1: A visit from a penpal- t3,t4

Ngày tải lên : 16/09/2013, 13:10

... about Malaysia: Is Malaysia one of the countries of the ASEAN? climate: tropical climate Unit of currency: Riggit 5- Capital city: Kula lumpur Official religion: Islam 7.National language: BahasaM ... introduce a the passage by showing 15 the map and the picture about Malaysia - T asks “What you know about Malaysia - T asks sts to read the passage silently and underline the new words - T explains ... (translation method) - T reads the passage and students listen and find the right information about Malaysia to fill in the table (pair word) - Sts answer (in Vietnamese) - Reading the passage...

6
631
0

unit1: A visit from a pen pal

Ngày tải lên : 17/09/2013, 03:10

... capital of Malaysia is JakarTa 3-Education is free in Malaysia 4-Malaysia has Twins-towers 5-The currency in Malaysia ia VND III-While-reading Keys: 1-T 2-F 3-F 4-T 5-F Task 1: Fill in the table ... -Set the scene: you are going -listen the situation to read a passage about III-Listen and read Maryams visit to Ha Noi Modal: -Read the passage and ask sts Lan used to walk past the mosque to ... wearing an Ao dai She comes from Viet nam - He is wearing a Kilt The comes from Scotland - She is wearing a Sari She India - He is a Cowboy He the USA - She is a Veil She Saudi Arabia...

172
3.8K
4

A VISIT FROM PEN PAL

Ngày tải lên : 19/09/2013, 02:10

... taking part in building the new lesson Lan – Maryam *Who are they ? *Where is Maryam from? *Lan and Maryam *Malaysia “Maryam is Lan’s pen pal from Malaysia It’s the first time Maryam visited Hanoi” ... (Nga) Who is Nga ? (Lan’s friends) What are they doing ? (waiting for Lan) Nga – Maryam *Nga and Maryam *Who are they ? “This is the time Nga and Maryam meet each other They are talking to each ... Correcting and evaluating - Hanging the poster on the board and eliciting the poster - Running through the poster - Asking Ss to ask and answer about Ba , Lan , Nam and Hoa - Listening and taking part...

14
449
0

Tài liệu Saving and Loading a DataSet from XML pptx

Ngày tải lên : 24/12/2013, 05:15

... schema from the data, and loads the data into the DataSet The DataSet schema is extended by adding new tables and columns as required ReadSchema Reads any inline schema and loads the data into ... settings: Auto • • • DiffGram if the data is a DiffGram ReadSchema if the DataSet already has a schema or the XML document contains an inline schema InferSchema if the DataSet does not already have a ... schema and the XML document does not contain an inline schema Auto is the default DiffGram Reads a DiffGram applying the changes to the DataSet The target DataSet must have the same schema as the...

11
429
1

Tài liệu Bust a Move with Your SSIS – Passing Package Variables docx

Ngày tải lên : 17/01/2014, 06:20

... demonstrates a control flow containing a looping task, several SQL tasks, and a dataflow using a merge object Declaring package variables and passing variable values between tasks requires careful attention ... is case-sensitive and must match a package variable name, with the @ prefix necessary in this property page For example, the variable @MaxRows matches the MaxRows package variable An appropriate ... = @NumLastNames - cast(rand(@counter) * @NumLastNames as int) Get a first name and last name pair using a random pointer pair select @fname = FirstName, @lname = LastName from fname,lname where...

15
362
1

Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc

Ngày tải lên : 24/01/2014, 07:20

... in one day as a gas station attendant earns in a whole year? Because he or she has a rare and specialized skill that is critical when needed Put bluntly, there are millions who can pump gas, but ... known as Wal-Mart stores, in hundreds of small towns across America Sam Walton was a true master of the SpeedWealth system He died a few years ago as one of the richest people on the planet, amassing ... such as giving massages, there is a definite ceiling on your income Let’s face it, there are only so many massages a masseuse can give in a day! The same limitations hold true if you are a counselor,...

102
646
0

Tài liệu Excerpts From Your Word is Your Wand By Florence Scovel Shinn ppt

Ngày tải lên : 26/01/2014, 15:20

... killed more people than war For example: There was a woman who was healthy and happy and married to a man she loved The man died and left part of his estate to a relative The woman was filled with ... inevitably drift apart Thought is a tremendous vibratory force and man is drawn to his thought creations For example: A man and woman married and were apparently happy The man became successful and ... wand and he transmutes apparent failure into success He knows his universal supply is endless and immediate and all his needs manifest instantly on the external For example, a woman at sea awoke...

42
488
0

Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

Ngày tải lên : 14/02/2014, 06:20

... for a particular nutrient Statistical Analysis All anthropometric measurements were made in duplicate and the means of paired values were used in the analyses The data were statistically analyzed ... Pakhtunkhwa (Previously: NWFP), 25000, Pakistan Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... one-way analysis of variance (ANOVA), and post-hoc comparisons with Dennett’s test taking the normal weight group as reference BMI-adjusted partial correlation coefficients were calculated to establish...

9
525
0

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Ngày tải lên : 14/02/2014, 21:20

... radiotherapy in management of cancer pain Pain Cause Bone pain Metastases Pathological fracture (non-surgical e.g rib / pelvis) Headache Primary cerebral tumour Brain metastases Abdominal pain ... Moscol A, Zaharia M, Zaman S, Perez Escutia MA Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic metastatic bone disease: a randomised phase III trial ... be associated with a transient flare-up of pain that needs to be managed with the appropriate manipulation of analgesia 4.2.2 Thoracic pain • The common causes of intra-thoracic pain in malignancy...

116
548
0

Tài liệu The ZEN Approach™ to Project Management Working from your Center to Balance Expectations and Performance docx

Ngày tải lên : 18/02/2014, 07:20

... question “Who am I?” Each time you arrive at an answer (“I am Joe, I am Sue’s father, I am a manager, I am an American,” you ask the question again, and each time an answer is reached, the answerer ... for example, when you have read a paragraph or, maybe, several pages, but have no idea that you’ve read it or what was in it) just bring your awareness to your body and breath and begin again ... I’m awake I’m reading and thinking, am I not?” But what does it mean to be awake in the way that a Buddha is awake? “Buddha” literally means awakened one, and this book is about what it means...

23
498
0

Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

Ngày tải lên : 19/02/2014, 06:20

... disulﬁram Alcohol Alcohol 28, 461–468 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawamoto T (2002) Diminished alcohol preference in transgenic ... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of transcription factors NF-kappa B and AP-1 by acetaldehyde ... supernatant (200 lL) obtained after centrifugation at 4308 Acknowledgements We thank Dr V M Sadagopa Ramanujam (The University of Texas Medical Branch, Galveston, TX) for help with metal analyses...

11
473
0

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Deﬁnition" pptx

Ngày tải lên : 19/02/2014, 19:20

... Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation using measures ... International Joint Conference on Artiﬁcial Intelligence, pages 805–810 David M Blei, Andrew Y Ng, and Michael I Jordan 2003 Latent dirichlet allocation Journal of Machine Learning Research, Samuel ... Natural Language Processing and Computational Natural Language Learning Christiane Fellbaum 1998 WordNet: An Electronic Lexical Database MIT Press Thomas L Grifﬁths and Mark Steyvers 2004 Finding...

5
585
0

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Ngày tải lên : 20/02/2014, 23:20

... AWAWALGWDDK GYHENA WPLDYFL TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone ... indicated in the right of each row The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed A putative signal peptide is indicated by a dotted ... medicals, Inc (OH, USA), TOYOPEARL CM-650 M was from Toyo Soda Mfg, Co (Tokyo, Japan), Sephacryl S-200 HR was from Amersham Pharmacia Biotech AAB (NJ, USA), and Hydroxyapatite (Fast Flow Type) was...

8
511
0