... finished garment will actually measure 42" A much looser-fitting garment might Anna’s Tip have 10" of ease or The amount of ease more As you can in a garment is critiimagine, ease dramatically changes ... the same places You will add generous seam allowances to the pattern, then cut the trial pants out of muslin and baste the seams After fitting and marking, you will take apart the trial pants and ... the marks above and below If they are right, sketch a line that averages two or three seamline marks 3" Step – Add Seam Allowances crotch line Add seam allowances around the entire pattern as follows:...
Ngày tải lên: 12/08/2015, 14:57
Ngày tải lên: 12/08/2015, 14:55
Báo cáo y học: "A stabilized HIV-1 envelope glycoprotein trimer fused to CD40 ligand targets and activates dendritic cells" pps
... motif (IZ) based on GCN4 (AGAATGAA GCAGATCGAGGACAAGATCGAGGAGATCCTGAGCAAGATCTACCACA TCGAGAACGAGATCGCCAGAATCAAGAAGCTGATCGGCGAGAGA, which encodes the peptide sequence RMKQIEDKIEEILSKIYHIENEIARIKKLIGER ... [46]), was annealed using two 5’sense oligonucleotides, 5’IZ1Age1Bgl2: 5’CCGGTAGAATGAAGCAGATCGAGGA CAAGATCGAGGAGATCCTGAGCAA-3’ and 5’IZ2Bgl2Not1: 5’-GATCTA CCACATCGAGAAC GAGATCGCCAGAATCAAGAAGCTGATCGGCGAGAGAGGC-3’ ... antisense primers (5’mCD40L1BamH1 [5’CTCATACTCATAGGATCCTCGATCCTCAAATTGC AGC-3’] and 3’mCD40LSfu1 [5’-CTCATACTCATATTCGAATTAGAGTTTGAGTAAGCC-3’]) The PCR product was cloned downstream of the SOSIP.R6 ORF...
Ngày tải lên: 13/08/2014, 01:21
Kế toán nguyên vật liệu để may áo Jacket 3 lớp có mũ tại Công ty cổ phần Happytex - Việt Nam
... nghờ may ỏo Jacket lp cú m( Phu luc 3.8) 3.3 Kờt qu iờu tra trc nghim va kờt qu tụng hp anh gia ca cac chuyờn gia vờ kờ toan nguyờn võt liu sn xuõt ao Jacket lp co m ti Cụng ty Cụ phn Happytex ... toan mua hang va cụng n phi tr/ cõp nhõt sụ liu/ Danh muc nha cung cõp - Vi cỏc nh cung cp mi thỡ k toỏn tin hnh khai bỏo bng vo phõn h Kờ toan hang tụn kho/ cõp nhõt sụ liu/ Danh muc hang hoa ... luc 3.25) Sau ú k toỏn tin hnh in s cỏi ca mt ti khon, k toỏn thc hin vo phõn h kờ toan tụng hp/ Sụ sach CTGS/ Sụ cai ca mt tai khon, chon Tai khon, chon thi gian : T ngay/ ờn ngay/ Nhõn/F7-...
Ngày tải lên: 24/03/2015, 10:59
ĐỒ án CÔNG NGHỆ MAY áo JACKET nữ
... miệng túi May chặn lưỡi gà Diễu mí miệng túi May bao túi Thân sau Ráp đô sau vào thân sau Diễu đô sau May bass vai Diễu bass vai May tay May mang tay lớn + mang tay nhỏ lại với và diễu ... 1,74 1,86 May vai Vắt sổ vai Vắt sổ bo lai tay Tra bo vào tay Tra nách tay vào thân Vắt sổ vòng nách Tra sườn tay vào sườn thân Vắt sổ sườn May thun vào lai thân sau 0,17 0,17 ... , biên vải quay về phi a người cắt , vẽ lai bên tay trái , vẽ cổ bên tay phải - AB : Dài áo = Số đo -2 chồm vai - AC : Ngang vai = ½ vai - 0.5 cm - CC1 : Hạ vai = 1/10 vai + 0.5...
Ngày tải lên: 13/06/2016, 16:19
2000 thi bang A va B.pdf
... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... are tall a the b a c an d no article > d 54 Hoa is good pupil a the b a c an d no article > b 55 That is a bag It is on table a the b a c an d no article > a 56 We are in same class ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...
Ngày tải lên: 05/08/2012, 12:28
How to Write a Marketing Plan
... threats Part 2: Situational Analysis Financial Analysis for Product or Product Line Much of this information can be handled within a graphical format, such as tables and graphs, though a paragraph ... conditions and circumstances facing the company that are not easily seen within financial measures For instance, a company may report strong sales for a product but market share information may suggest ... Other Areas Preferably this section includes a brief summary of current marketing decisions (see Situational Analysis) so readers of the plan can easily compare what was planned to what is planned...
Ngày tải lên: 08/08/2012, 15:18
Tài liệu luyện thi cấp tốc Đại học khối A.doc
... thu c hn hp gm 28,48 gam Ala, 32 gam Ala-Ala v 27,72 gam Ala-Ala-Ala Giỏ tr ca m l A 90,6 B 111,74 C 81,54 D 66,44 Gii: Ala-Ala-Ala-Ala + H2O Ala + Ala-Ala + Ala-Ala-Ala 0,32 0,2 0,12mol 0,32 ... cho 0,04 mol Ag thỡ ch cú anehit fomic ( HCHO) m thụi n Ag = A ỳng Cỏch n H O = n CO anehit no n chc (loi B, D) Ta cú: nX Cõu 31: Thy phõn ht m gam tetrapeptit Ala-Ala-Ala-Ala (mch h) thu ... sau õy lm qu tớm i thnh mu xanh? A Dung dch alanin B Dung dch glyxin C Dung dch lysin D Dung dch valin gii: A CH 3CH(NH )-COOH Alanin (axit -aminopropioni c) B H N-CH -COOH glixin (axit aminoaxetic)...
Ngày tải lên: 14/08/2012, 11:06
Thiếu vitamin A.pdf
... vitamin A ruột : a chảy kéo dài, lỵ, tắc mật - Do suy gan : gan có vai trò quan trọng chuyển h a vitamin A Vitamin A tan mỡ, gan tiết mật điều h a chuyển h a mỡ giúp chuyển h a vitamin A Hơn gan ... Dùng n a liều Nếu trẻ nôn, a chảy: Cho tiêm bắp loại vitamin A tan nước với liều n a liều uống 7.2 Cứ - tháng sau lại cho tiếp liều vitamin A 200 000 đơn vị 7.3 Ngoài cho vitamin A ra, cần phải ... UI vitamin A - Trẻ tuổi : Cứ - tháng cho uống 200.000 UI vitamin A - Các bà mẹ có thai : Không dùng liều cao thời kỳ mang thai sợ gây quái thai - Bà mẹ sau sinh : uống 200.000 UI vitamin A để...
Ngày tải lên: 17/08/2012, 10:38
Phương thức sản xuất Châu á và việc nghiên cứu ở VN.doc
... Nam từ năm 60 tới nay, vấn đề mà nhà nghiên cứu quan tâm nhiều có hay phương thức sản xuất châu Á Việt Nam? Nếu có thời điểm bắt đầu kết thúc nào? Từ hoạt động khoa học trên, ta thấy Việt Nam ... khác, tác giả cho xã hội Việt Nam chuyển sang giai đọan Á Châu phong kiến h a mạnh mẽ vào kỷ XIV Mặc dù quan điểm Lê Kim Ngân mang tính chất tiến Nhưng gây nhiều tranh cải nhiều khuynh hướng khác ... 1980… Mặc dù tác giả ch a đ a mốc thời gian cụ thể tác giả cho sau chế độ công xã nguyên thuỷ Việt Nam bước vào xã hội có giai cấp sơ kỳ mang đặc trưng “hình thái Á châu” hay phương thức sản xuất...
Ngày tải lên: 17/08/2012, 13:18
Planning a Service-Oriented Architecture
... leverage fragmented applications and processes and reuse them again and again across the enterprise For example, if one application in the marketing department can get to customer or inventory data ... of redundancy and breaking silos, SOAs should bring increased operational simplicity allowing dialing cost increases to a sustainable rate The elimination of redundancy and a 15% increase in efficiency ... technology," says BEA's Patrick "Our experience has been that if all you is take a technology approach to this problem … you can a really great job and quick hit a wall." I • How will the SOA affect...
Ngày tải lên: 20/08/2012, 11:43
Best Practices for Developing a Web Site
... the day was “Do you have a Web site?” A well-designed Web site was a new and exciting marketing medium that businesses and users alike saw as a novel, nice-to-have tool Fast-forward a decade and ... hosting package, the following table can be used to evaluate potential domain name registrars separately from Web site hosts: Evaluating Domain Name Registrars Features and Criteria Cost per year Cost ... never a good idea to settle on your first candidate You should take a high level look at a broad range of designers and make a list of the potential candidates that meet your criteria Then, narrow...
Ngày tải lên: 20/08/2012, 11:43