Ngày tải lên: 13/02/2014, 16:20
... influenced the debate during the CBD negotiations and one can even go further, by saying that, it continued to influence the implementation of the CBD both at the national and international level ... implementation of the Nagoya Protocol is critical for operationalisation of the ABS framework at the National level The indicators derived demonstrate that what will happen with regard to the implementation ... implementation of the ABS instruments at the domestic and international level This will foster the move towards achieving the three objectives of the CBD At the time of her work the negotiations...
Ngày tải lên: 02/12/2015, 01:11
Báo cáo "A nalyse the fluctuation and water level trend in Saigon- Dong Nai river system " ppt
Ngày tải lên: 22/03/2014, 12:20
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study
... strain and that the accuracy of the results not depends on Kt and the material Eq (3) is valid till the yielding onset at the notch root To consider the situation of general yielding at the notch ... states and full elastic behaviour, the stress at the notch root can be calculated based on the nominal stress and corrected by the theoretical stress concentration factor Thus, assuming that ... (1985) to estimate the non-elastic stress and strain levels at the notch root allowed to conclude that, in the presence of local yield at the root of the geometrical discontinuity, the density of...
Ngày tải lên: 24/05/2014, 20:32
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG...
Ngày tải lên: 07/03/2014, 15:20
AUDIT OF COMPLIANCE WITH STANDARDS GOVERNING COMBINED DNA INDEX SYSTEM ACTIVITIES AT THE COUNTY OF SANTA CLARA DISTRICT ATTORNEY’S CRIME LABORATORY SAN JOSE, CALIFORNIA potx
... three distinct levels that flow upward from the local level to the state level and then, if allowable, the national level The National DNA Index System (NDIS), the highest level in the hierarchy, ... responsibilities and obligations of laboratories that participate in the CODIS program at the national level The MOU describes the CODIS-related responsibilities of both the Laboratory and the FBI The NDIS Procedure ... the perpetrator or the murder The case file did not contain any information that placed the putative perpetrator inside the car where the cigarette butt was found, but rather indicated that the...
Ngày tải lên: 29/03/2014, 22:20
Báo cáo khoa học: Aromatic amino-acid residues at the active and peripheral anionic sites control the binding of E2020 (AriceptÒ) to cholinesterases doc
... Trp84 at the bottom of the gorge, the piperidine ring interacts with Tyr70, Asp72, Tyr121 and Tyr334 in the middle of the gorge, and the indanone ring interacts with Trp279 at the lip of the gorge ... BChE, the interaction of the phenyl ring of E2020 at the active-site has to be compromised These results suggest that the larger dimension of the BChE gorge and the lack of aromatic residues in the ... workstation using the molecular simulation software INSIGHT II The coordinates of Mo AChE–(R)-E2020 complex were generated using the crystal structure coordinates from the Protein Data Bank The...
Ngày tải lên: 30/03/2014, 20:20
Environmental Innovation Dynamics in the Pulp and Paper industry potx
... applied, such as water charges in the Netherlands and the electricity tax in Finland The evidence on the relationship between environmental policy instruments and innovation suggests that these instruments ... potential negative correlation between environmental innovation and sunk costs The research suggests that no matter what the regulator does, because there will be much lobbying and negotiations undertaken ... Co-generation of heat and power Membrane filtration and ozonation Low NOx boilers Anaerobic and aerobic biological treatment Partly recycling of treated water Kidney treatment for further cleaning and re-use...
Ngày tải lên: 01/04/2014, 00:20
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants
... Observations 138 138 Note: ***, **, and * represent statistical significance at the 1%, 5%, and 10% levels, respectively a Standard errors are in parentheses (heteroskedasticity consistent standard ... in the control menu treatment received no nutritional information, patrons in the calorie-only menu treatment were provided the number of calories in parentheses before each item’s price, and ... income, and education The average levels of health consciousness were also compared across the categories of diners as well as the proportion of people who responded that taste or health was the...
Ngày tải lên: 08/04/2014, 18:33
EFFECT OF STORAGE TEMPERATURES ON THE PHYSIOLOGICAL AND BIOCHEMICAL PROPERTIES OF HYLOCEREUS POLYRHIZUS
... percentage of yield 77 ix the and the and Table 4.10 Analysis of variance (ANOVA) of the response surface quadratic model for the DPPH, FRAP, ABTS, and yields of Limnophi/a aromatic extract Table 4.11 ... expressed as mean ± standard deviation BHT was used as the standard 78 Figure 4.17 3D response surface plot showing effects of sample to solvent ratio and solvent to water ratio at constant time (18 ... effects of time and sample to solvent ratio at constant solvent to water ratio (60%) in FRAP assay 85 Figure 4.19 3D response surface plot showing effect of time and solvent to water ratio at constant...
Ngày tải lên: 05/05/2014, 08:39
ecstasy the complete guide a comprehensive look at the risks and benefits of mdma
... psychiatric literature as the "capacity to understand what another person is experiencing from within the other's frame of reference (standing in the other's shoes) In empathy one feels as the other ... general psychotherapeutic value of MDMA was "very positive." More than three fourths of these therapists stated that their patients had improved greatly in insight-based therapies and that the overall ... to the transporter, the transporter changes shape (or configuration) and moves the 5-HT to the inside of the cell, where the 5-HT "falls off' and is released into the cytoplasm of the cell The...
Ngày tải lên: 03/07/2014, 16:07
Báo cáo y học: "Clinical review: Drotrecogin alfa (activated) as adjunctive therapy for severe sepsis – practical aspects at the bedside and patient identification Pierre-François Laterre and Xavier Wittebole" pdf
... implies that the benefit of the drug after this delay has not been evaluated Prolonging the waiting period between initiating adequate standard care and evaluating whether the drug is indicated is ... In the PROWESS study, three patients had an ICH (one patient receiving the placebo and two receiving drotrecogin alfa [activated]) [1] For these latter patients, clinically evident disseminated ... serum concentration and drug half-life did not differ between patients with renal failure and the population overall [17] Based on these data, patients with end-stage renal failure and chronic...
Ngày tải lên: 12/08/2014, 19:22
communication style at the vietnamese and american workplace = phong cách giao tiếp công sở ở việt nam và mỹ
... communication style at the workplace? - What are the similarities and differences in the communication style at the Vietnamese and American workplace? 1.3 Significance of the study It is hoped that ... presents the rationale, the objectives, the scope, the significance, the methods and the design of the study Chapter 2: Theoretical background starts with the definitions of culture, communication and ... consideration It is the ways that are used within the organization to help colleagues to transmit messages and information Organization uses communication system to link people together and make them...
Ngày tải lên: 02/03/2015, 14:30
A research on evaluating User satisfaction when applying the VANPRO software at the education and training of Dien Bien Province
... applications in the planning Application of information technology in data collection, analysis and assessment of the state of education is very important and necessary for planning If the state ... annual and five-year period of the school, the Education and Training, the Department of Education and Training This software helps the user to collect and forecast the number of school-age population, ... state of education is appreciated, we will identify the objectives and targets of the plan At the same time, we will also have the solution, good for the development of education policy Therefore,...
Ngày tải lên: 20/07/2015, 21:08
Communication style at the Vietnamese and American workplace
... implication for people working in intercultural working environment, the limitations of the study in which the author states the reasons for the study’s limitations, and suggestions for further ... reasons for the selection and the description of the participants; the data collection instruments in which the instrument and procedure of data analysis are discussed; methods of data collection ... communication style, which leads to problems occurring when Vietnamese and American people communicate at the workplace Then, the findings are analyzed and discussed Chapter 5: Conclusion presents the...
Ngày tải lên: 10/08/2015, 19:51
Have got has got look at the pictures and answer questions 3
Ngày tải lên: 25/08/2016, 12:17
49323 look at the pictures and make sentences using passive voice
Ngày tải lên: 29/08/2016, 19:48
ENHANCING THE EFFICIENCY OF THE QUALITY MANAGAMENT SYSTEM BY IMPROVING MANAGEMENT RESPONSIBILITY AND HUMAN RESOURCE MANAGEMENT AT VIET A PLASTIC AND COMPOSITE COMPANY
... Researching and understanding customer needs and expectations Ensuring that the objectives of the organization are linked to customer needs and expectations Communicating customer needs and expectations ... management systems When managers use a process approach, it means that they manage the processes that make up their organization, the interaction between these processes, and the inputs and outputs that ... throughout the organization Measuring customer satisfaction and acting on the results Systematically managing customer relationships Ensuring a balanced approach between satisfying customers and other...
Ngày tải lên: 18/04/2013, 17:09
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... presentation And the same number answered that they gathered ideas from other students in group talk More than 60 % of the students thought they corrected pronunciation mistakes of each other and ... that the information collected will not be used towards their course grades It is important for them because a non-threatening atmosphere is established and at that time communications in the ... they speak and the more they speak, the more fluent they become in English In short, most of the students responded that they found satisfied when they participated in group talk and group work...
Ngày tải lên: 07/09/2013, 13:02
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... group work - Relationship between group work and individual presentation Objectives of the study contribute more theory to the understandings of group discussion find out the essentials of ... Methods of the study Qualitative : - Observation - Questionnaire Quantitative: - Descriptive statistics Subjects of the study 16 post-elementary non major students all of them learned ... presentations is really useful Group planning should be applied and encouraged in the classroom Further study: - Investigate in three areas: fluency, complexity and accuracy - Find out other...
Ngày tải lên: 29/01/2014, 10:33