strengths and challenges to mental health in a shifting society

SUSTAINABLE DEVELOPMENT AND THE FUTURE

SUSTAINABLE DEVELOPMENT AND THE FUTURE

... Desertification: Formation of deserts in arid and semi - arid regions due to change in climate and overgrazing Detritus: Any organic waste from plants and animals Dinoflagellate: Small organism floating ... (groundwater and surface water) Water pollution: chemical and bacterial contamination of groundwater and surface water Air pollution: urban air pollution, acid deposition, UnsustainUnsustainPoverty ... deteriorated Humans, animals, and plants have been affected Toxic pollutants cause many kinds of illnesses in humans and animals Oxides of nitrogen and sulfur, the ozone, and other pollutants are causing...

Ngày tải lên: 03/10/2013, 09:20

25 563 2
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc

Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc

... Hindoo character, and the drama and historical plays came in, generalities gave way to definite localizing, and in the Epics ornate descriptions of actual landscape took independent place Nature's ... sympathy with human joys and griefs was taken for granted, and she played a part of her own in drama In the _Mahõbhõrata_, when Damajanti is wandering in search of her lost Nala and sees the great ... For instance, the Romans appreciated landscape as a whole, and distance, light and shade in wood and water, reflections, the charms of hunting and rowing, day-dreams on a mountain side, and so...

Ngày tải lên: 21/02/2014, 20:20

194 634 0
The work of savings banks in microcredit in Europe (10 May 2011) Joint conference of the European Savings Banks Group (ESBG) and the European Microfinance Network (EMN) held in Brussels, Belgium pot

The work of savings banks in microcredit in Europe (10 May 2011) Joint conference of the European Savings Banks Group (ESBG) and the European Microfinance Network (EMN) held in Brussels, Belgium pot

... Social Affairs and Inclusion, with the participation of Fernando Vega from Cajasol (Banca Cívica Savings Banks, Spain), and Perrine Lantoine-Rejas from Féderation Nationale de Caisses d’Epargne ... philanthropy or a way of doing business? Microfinance today is not sustainable completely, thus there is a need to adapt the model in order to make it sustainable; it’s a social approach and a ... leave social exclusion The average period to obtain a loan (without any collateral) can take up to 1.5 months, including a visit to potential borrowers According to Mr Vega, a 6.5% interest rate...

Ngày tải lên: 06/03/2014, 10:20

7 434 0
Economic Development and the Escape from High Mortality pdf

Economic Development and the Escape from High Mortality pdf

... Typhus A0 36 A0 30 Malaria A0 37 A0 31 Other infectious A0 06 A0 11, A0 13, A0 03, A0 05, diseases A0 15, A0 18 A0 20, A0 12 A0 14, A0 25 A0 27, A0 29, A0 18, A0 20, A0 30, A0 33 A0 35, A0 21, A0 26 A0 29, A0 38 A0 43 A0 32 A0 44 ... 1980–90 Urban areas Rural areas Big cities, >1 million Asia Latin America and Caribbean Sub-Saharan Africa North Africa/Near East Small cities, 50,000–1 million Towns,

Ngày tải lên: 17/03/2014, 08:20

26 643 0
Sustainable Urban Development and the Chinese Eco-City pptx

Sustainable Urban Development and the Chinese Eco-City pptx

... 2007) Many scholars argue that markets are the single most important causal factor driving urbanization in China today Land, labor and other resources are being allocated increasingly in accordance ... pertaining to urban development and its associated sustainability issues, eco-city planning and how and why this has become an area of focus in urban China It also provides a backdrop to understanding ... crisis and this event could have an impact on urban forecasting In China, growth has halted and migrants living in cities in China are having a hard time finding work As reported by LaFraniere...

Ngày tải lên: 19/03/2014, 11:20

93 325 0
mastering xpages [electronic resource] a step-by-step guide to xpages application development and the xsp language

mastering xpages [electronic resource] a step-by-step guide to xpages application development and the xsp language

... www.ibm.com/legal/copytrade.shtml Java and all Javabased trademarks and logos are trademarks or registered trademarks of Oracle and/ or its affiliates Microsoft, Windows, Windows NT, and the Windows logo are ... Scripting,” gives an overview of Server Side JavaScript scripting objects and supporting libraries This chapter also examines ways to integrate custom Java classes and create Managed Beans Chapter ... experience and documentation teams also worked closely with us and helped bring clarity and objectivity to all we Our thanks to all: Andrejus Chaliapinas, Brian Gleeson, Darin Egan, Edel Gleeson, Graham...

Ngày tải lên: 31/05/2014, 00:46

321 1,2K 0
philips sarah d. women's social activism in the new ukraine. development and the politics of differentiation. bloomington, 2008

philips sarah d. women's social activism in the new ukraine. development and the politics of differentiation. bloomington, 2008

... gender, leadership, and individualization that mark and mobilize differentiating processes in the transnational NGO advocacy sector Maryna, Vira, and Sofiia are profiled in chapter on claims and class ... the rapid expansion of civic organizing in Ukraine We examine the history of women’s organizing in Soviet and post-Soviet Ukraine, and I invite readers along to a “training” seminar on women and ... Ukrainian economy appears to be leading in a meandering and contradictory fashion to the trimming back of social welfare systems and an ongoing politics of differentiation Examining emerging social...

Ngày tải lên: 04/06/2014, 17:40

233 395 0
báo cáo khoa học: " The development and geometry of shape change in Arabidopsis thaliana cotyledon pavement cells" doc

báo cáo khoa học: " The development and geometry of shape change in Arabidopsis thaliana cotyledon pavement cells" doc

... regression analysis using Minitab software (Minitab, Quality Plaza, PA) To calculate the isotropy factor for the to DAG growth interval, manually extracted DAG cells were digitally magnified to yield a ... the raw data for the population and time-lapse imaging and analyzed the population data DS carried out the GFP-TUB6 live cell imaging DS and CZ drafted the manuscript All authors read and approved ... software The growth of cells from DAG to DAG was calculated as (5 DAG area DAG area)/(3 DAG area)/48 hr*100% Microscopy Additional material Arabidopsis thaliana (Col-0) seedlings were grown in...

Ngày tải lên: 11/08/2014, 11:21

13 398 0
carroll - delusions of development; the world bank and the post-washington consensus in southeast asia (2010)

carroll - delusions of development; the world bank and the post-washington consensus in southeast asia (2010)

... of Abbreviations AAA Analytical and Advisory Activities/Assistance ADB Asian Development Bank AJI Alliance of Independent Journalists Indonesia (Aliansi Jurnalis Independen) BAPPENAS Indonesian ... project at hand and the state form that accompanies it, and the work of all three has been seminal in conceptualising SIN In operationalising an analysis of SIN, I was crucially interested in making ... DEMOCRATIZATION IN SOUTHEAST ASIA A Study of the Nation-State, Regional and Global Order Barry Wain MALAYSIAN MAVERICK Mahathir Mohamad in Turbulent Times Robert G Wirsing and Ehsan Ahrari (editors)...

Ngày tải lên: 03/11/2014, 12:59

286 275 0
Executive summary Proceeding of the international conference "sustainable development and ethnic minority poverty reduction in mountainous regions"

Executive summary Proceeding of the international conference "sustainable development and ethnic minority poverty reduction in mountainous regions"

... focusing on livelihood and market linkages, natural resource management, cultural diversity, education and health care, climate change and environment, and poverty analysis and evaluation Poster and ... P135-2 and the Northern Mountains and Central Highlands CDD projects, as well as operations focused on water and sanitation, transport, and energy in rural areas The Bank has been (and continues to ... supply, maintaining ecological balance, climatic conditions and more subregion to facilitate the development of agriculture, forestry and animal husbandry In addition, ethnic minority and mountainous...

Ngày tải lên: 11/08/2015, 09:36

19 260 0
Identities on hyperbolic surfaces, group actions and the markoff hurwitz equations

Identities on hyperbolic surfaces, group actions and the markoff hurwitz equations

... his way of thinking and working that the important ingredients for a sound research, or for other meaningful endeavors as well, are thought-provoking ideas and long-lasting perseverances In addition, ... Xingwang Xu, Associate Professor Kai Meng Tan, Professor Chengbo Zhu, to name just a few In particular I learned some useful knowledge in geometrical theory and also in mathematical programming ... In addition Schmidt and Sheingorn in [38] provided a proof “intermediate”, as in their own word, to McShane’s original proof and Bowditch’s proof Applications Bowditch in [8] obtained a variation...

Ngày tải lên: 10/09/2015, 09:09

110 204 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2

... Protein Quantification by Bradford Assay Bradford assay was used to quantify proteins in cell lysates It is a rapid and accurate method commonly used to determine the total protein concentration ... specificity testing 2.1.2.3.1 DAGK Assay DAGK assay was established and described by Bollag and Griner et al (1998) In this assay, DAGK is incubated with its substrate (diacylglycerol), and a mixture ... containing 20% glycerol, 1mM mercaptoethanol, 1mM EDTA, 1mM sodium orthovanadate (SOV), 1mM PMSF, 1mM Aprotinin, 1mM Leupeptin and 1mM Pepstatin A The buffer was stored at 4℃ and the protease inhibitors...

Ngày tải lên: 11/09/2015, 16:06

32 310 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 3

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 3

... Leptin Primer sequence FW: atgctggctatgagcaggtc RW: gtgcagagacagcaggttca FW: ggaggaagctgtgaagatgc RW: gcacagcaacagtgagcagt FW: gcagagtccagcaaaggt RW: cagccattgatacaggtagc FW: actaccatgagaattgcagtga ... actaccatgagaattgcagtga RW: tcctcagaacttccagaatcag FW: ccacctggactacatcgg RW: tcctcatccctctcatacag FWD: aaccttagatgggggtgtcc RWD: gtggaagtgacgcctttca FWD: ccggtttatcaactggatgg RWD: tggatcgaggccagtaattc FWD: tgacaccaaaaccctcatca ... 0.5% NH3OH was added into each well, the staining color became redder (as the pH became more alkaline), and more visible The staining was quantified by measuring the absorbance at 500nm, and the...

Ngày tải lên: 11/09/2015, 16:06

58 249 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4

... aliquoted into tubes, and the methanol was evaporated by a stream of nitrogen A suitable amount of 0.1% fat-acid free bovine serum albumin (FAF-BSA) was then added into the tubes to make 10mM S1P-BSA ... passage 8, and passage 9, and the cell surface marker expression profile in human AD-MSCs was tested in passage 5, passage 6, and passage Mouse IgG1 and IgG 2a were used as isotype controls, and five ... S1P in human BM- and AD- MSCs proliferation Figure 4.1 3A and Figure 4.13C show that in human BM- and AD- MSCs, 1μM of S1P triggered a very fast MAPK (P42/44) activation (at 5min), and sustained...

Ngày tải lên: 11/09/2015, 16:06

31 246 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 5

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 5

... report on inhibitors of SPHK mediating human BMand AD- MSCs differentiation into osteogenic and adipogenic paths Thus, the results presented here contribute to the current understanding of human MSCs ... therapeutic applications to balance the abnormal portions of osteoblasts and adipocytes observed in bone diseases such as osteoporosis and osteopenia, where the bone volume is decreased but the adipose ... cells along specific differentiation path More work, including in vivo work, needs to be done to fully validate the potential for SPHK inhibitors in adult-stem cell differentiation In the final part...

Ngày tải lên: 11/09/2015, 16:06

5 268 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 6

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 6

... Yutaka Yatomi, et al (1999) “Sphingosine 1-Phosphate Formation and Intracellular Ca2+ Mobilization in Human Platelets: Evaluation with Sphingosine Kinase Inhibitors1.” J Biochem 126, 84-89 Yatomi, ... Latif, N., P Sarathchandra, et al (2007) "Characterization of structural and signaling molecules by human valve interstitial cells and comparison to human mesenchymal stem cells." J Heart Valve ... radiation-induced apoptosis and sustain hematopoietic reconstitution after coculture and cografting in lethally irradiated baboons: is autologous stem cell therapy in nuclear accident settings hype or reality?"...

Ngày tải lên: 11/09/2015, 16:06

25 467 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation

... an intracellular mediator, as well as an extracellular mediator by binding to its receptors to stimulate various downstream signaling pathways, to regulate cell survival, cell proliferation and ... 1.2 SPHK AND S1P REGULATION IN PATHOLOGICAL STATES SPHK and S1P have been suggested to be potentially involved in several pathological diseases, including in inflammatory diseases and cancer 1.2.1 ... substrate-sphingosine, into S1P S1P has dual functions On the one hand, it could act as an intracellular mediator and trigger numerous cellular events, including intracellular calcium release, and promote...

Ngày tải lên: 11/09/2015, 16:06

31 524 0
w