stability of the transgenic cell lines over a period of 30 months of subculture
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
Ngày tải lên :
23/03/2014, 09:21
... interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, ... inadequate ratios; for our assays, we aim for at least a 10 : ratio It was reasoned that with some cDNAs, even the low mRNA levels in the off-state generate, because of highly efficient translation, ... GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry U57609 For pEBTet ⁄ eGFP, the...
- 8
- 331
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Ngày tải lên :
18/06/2014, 22:20
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... evaluation of Cell Cycle Analysis (FACs), Ymin/T0 and EC50 values (See METHODS) Additional Table S2 Available Karyotype data for Cell lines treated with GSK1070916 Additional Table S3 Among cell ... in cell subpopulations For instance, the karyotype data for the TANOUE cell line has a chromosome modal number of 48 for the primary population of cells, but also 12% of the cell population was...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
Ngày tải lên :
20/06/2014, 04:20
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... evaluation of Cell Cycle Analysis (FACs), Ymin/T0 and EC50 values (See METHODS) Additional Table S2 Available Karyotype data for Cell lines treated with GSK1070916 Additional Table S3 Among cell ... in cell subpopulations For instance, the karyotype data for the TANOUE cell line has a chromosome modal number of 48 for the primary population of cells, but also 12% of the cell population was...
- 10
- 665
- 0
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
Ngày tải lên :
18/06/2014, 19:20
... 24:816-822 Andrade CR, Takahama Junior A, Nishimoto IN, Kowalski LP, Lopes MA: Rhabdomyosarcoma of the head and neck: a clinicopathological and immunohistochemical analysis of 29 cases Braz Dent ... determined The percentage of cells in G1 phase increased significantly whereas the percentage of cells in S phase and G2/M phase decreased (Table 2) In addition, there was also an increase in apoptosis ... Puri N, Ahmed S, Janamanchi V, Tretiakova M, Zumba O, Krausz T, Jagadeeswaran R, Salgia R: c-Met is a potentially new therapeutic target for treatment of human melanoma Clin Cancer Res 2007, 13:2246-2253...
- 10
- 402
- 0
báo cáo hóa học:" Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
Ngày tải lên :
20/06/2014, 03:20
... 24:816-822 Andrade CR, Takahama Junior A, Nishimoto IN, Kowalski LP, Lopes MA: Rhabdomyosarcoma of the head and neck: a clinicopathological and immunohistochemical analysis of 29 cases Braz Dent ... determined The percentage of cells in G1 phase increased significantly whereas the percentage of cells in S phase and G2/M phase decreased (Table 2) In addition, there was also an increase in apoptosis ... Puri N, Ahmed S, Janamanchi V, Tretiakova M, Zumba O, Krausz T, Jagadeeswaran R, Salgia R: c-Met is a potentially new therapeutic target for treatment of human melanoma Clin Cancer Res 2007, 13:2246-2253...
- 10
- 373
- 0
Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx
Ngày tải lên :
09/08/2014, 20:21
... Crypa, Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium tetraurelia, Tetth, Tetrahymena ... Homsa;CYCE2 Homsa;CYCE1 Arath;CYCB1;1 Arath;CYCB3;1 Thaps (33377) Thaps (36441) Phatr;CYCA/B;1 Homsa;CYCF Arath;CYCA1;1 Arath;CYCA2;1 Arath;CYCA3;1 Ostta;CYCA Homsa;CYCA1 Homsa;CYCA2 Homsa;CYCB2 ... (a) Growth rate of different subcultures after repletion based on average cell density measurements at the time of and days after repletion These data indicate the ability of the cells to recover...
- 19
- 452
- 0
Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx
Ngày tải lên :
12/08/2014, 04:20
... OLCABe31 and OLME-104 cells virus can multiply in all of the cell lines to a varying degree Virus spread To examine whether RGNNV spread occur in the medaka cell lines which lacked clear appearance of ... represents the merged image of Alexa488-fluorescence and DAPI staining (B) Rates for the infected cells against the total cells represented in Figures and 3A were calculated and shown periodically Adachi ... interference antagonist that facilitates intracellular viral RNA accumulation J Virol 2006, 80:85-94 Iwamoto T, Mise K, Takeda A, Okinaka Y, Mori K, Arimoto M, Okuno T, Nakai T: Characterization of Striped...
- 7
- 199
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
Ngày tải lên :
19/02/2014, 06:20
... HepG2 and HeLa cells were cultured for 48 h under normoxia or hypoxia, and then harvested The microsome fraction was prepared and used for the assay of HO activity The data are means ± SEM of three ... lg of total RNA The lane labeled h contained RNA prepared from untreated cells harvested just before starting the experiment At the bottom of each panel, 28S rRNA of each sample was visualized ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
- 12
- 621
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
Ngày tải lên :
30/03/2014, 11:20
... 130 1657; GenBank accession number AB000450) based on human VRK2 [7] VRK 2A: 5¢CCCGGATCCATGCCACCAAAAAGAAATGAAAAAT ACAAACTTCC-3¢ (nucleotides 130 165), this primer has the initiation codon and a BamH1 cloning ... need to have a basic mechanism that maintains a basal level of p53 in a state of readiness and able to respond to any stress that may arise in normal life, when most cells are in interphase [15] ... 14 Lazo PA, Vega FM & Sevilla A (2005) Vaccinia-related kinase-1 AfCS-Nature Molecule Pages 10.1038/ mp .a0 0302 5.0 0300 1 15 Vega FM, Sevilla A & Lazo PA (2004) p53 stabilization and accumulation...
- 18
- 333
- 0
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx
Ngày tải lên :
20/06/2014, 07:20
... with the following primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-TGCTGAGTATGTCGTGGAGTCTA-3' and 5'AGTGGGAGTTGCTGTTGAAGTCG-3' ... human epithelial ovarian tumor cell lines OVCAR-3, SKOV-3, and CAOV-3 were purchased from ATCC RT-PCR Total RNA was isolated from MOVCAR cell lines using the Qiagen RNeasy® Mini kit and μg of ... murine monoclonal antibodies that were initially generated against human MUC16 List of abbreviations EOC: epithelial ovarian cancer; ConA: Concanavalin A; αMe-Man: α-methylmannopyranoside Competing...
- 7
- 430
- 0
Tài liệu Báo cáo " The total specialization of modules over a local ring" ppt
Ngày tải lên :
13/02/2014, 03:20
... ground-form of pu The prime ideal pu is called a separable prime ideal if it’s ground-form is a separable polynomial We have the following lemma: Lemma 2.1.[1, Satz 14] A specialization of a prime separable ... a Cohen-Macaulay S -module (ii) LT is a maximal Cohen-Macaulay ST -module if L is a maximal Cohen-Macaulay S -module Proof We need only show that (LT )piT is a (maximal) Cohen-Macaulay (ST )piT ... -module as follows As above, the matrix A := ((aij )α) has all its entries in ST for almost all α Let FT and GT be free ST -modules of the same rank as F and G, respectively, and Bα is the matrix of...
- 7
- 500
- 1
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
Ngày tải lên :
19/02/2014, 05:20
... 3¢-UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢, antisense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢ Another HO-2-specific siRNA, HO-2 siRNA1 (target base ... siHO-2, was designed and synthesized by iGENE Therapeutics (Tsukubu, Japan), and scrambled HO-2 siRNA was used as a negative control: HO-2 siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG-3¢, antisense, ... Kimpara T, Takeda A, Watanabe K, Itoyama Y, Ikawa S, Watanabe M, Arai H, Sasaki H, Higuchi S, Okita N, et al (1997) Microsatellite polymorphism in the human heme oxygenase-1 gene promoter and...
- 14
- 487
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
Ngày tải lên :
21/02/2014, 01:21
... GAPDH gene [20] GAPDH mRNA was utilized as a constant mRNA for control Statistical analysis The statistical analysis of the data was performed using the unpaired Student’s t-test, assuming a ... of 100 lM NAMI -A and then processed as described in materials and methods Representative autoradiograms of the ribonuclease protection analysis of c-myc mRNA are shown in panel A Autoradiographic ... phosphorylation may be lying upstream of ERK1/2 Recent observations indicate that activation of Raf by PMA may trigger the same signaling pathway as oncogenic Raf, or Raf activation by Ras in combination...
- 10
- 703
- 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
Ngày tải lên :
07/03/2014, 12:20
... (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and GateHISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The resulting ... gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) ... (atactcgagccaccatgaagctttgcagccttgc) and CPU_rev_NotI (atcatgcggccgcttaaacattcctaatgacatgc caag), 0.2 mm dATP, 0.2 mm dGTP, mm dTTP, mm dCTP, 0.5 mm MnCl2, and 2.5 U of AmpliTaq DNA polymerase...
- 15
- 397
- 0
Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx
Ngày tải lên :
07/03/2014, 15:20
... increases in the sub-G1 population of cells, indicative of apoptosis (Fig 1) Analysis of SA-b-gal activity Cellular senescence-associated b-galactosidase (SA-b-gal) activity was assessed as previously ... blockades in the G1, S or G2 phases of the cell cycle, suggesting that the reduction in cell number may have been the result of a general and simultaneous blockade of all three phases of the cell ... The acquisition of data was performed within h using a FACSCalibur (BD Biosciences) Five thousand cells were analysed for each data point, and the percentages of cells in sub-G1 (apoptotic fraction,...
- 9
- 331
- 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
Ngày tải lên :
16/03/2014, 06:20
... running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural Sciences ... the QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC ... denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased the...
- 10
- 520
- 0
Temperature dependence of the quality of silicon nanowires produced over a titania supported gold catalyt
Ngày tải lên :
16/03/2014, 15:09
... both, the bare catalyst and the product may generate Raman bands, the spectra of a reference silicon wafer and that of the fresh catalyst are included in the figure The spectrum for the fresh catalyst ... obtained at 300 °C gave a very weak Si signal, and overlapped with the spectra of the fresh catalyst, indicating a low yield of metallic Si Another interesting variation in the Raman was observed ... fitting of the XPS spectra and the quantification of the surface atomic ratios were obtained with Gauss–Lorentz peaks, using the MultiPak software from Physical Electronics X-ray absorption characterization...
- 7
- 432
- 0
Báo cáo Y học: Synthesis and turn-over of the replicative Cdc6 protein during the HeLa cell cycle potx
Ngày tải lên :
17/03/2014, 23:20
... DNA replication Once proliferation has been initiated, mammalian cells express Cdc6 mRNA at all stages of the cell cycle with a several fold increase in mRNA abundance at the onset of S phase ... the preparation of nuclear extracts In these extracts, the phosphorylated hCdc6p in the control sample was at least as stable as the phosphatase-treated hCdc6p (Fig 3C) suggesting that nuclear ... hCdc6p-specific antibodies (see below) and used for the extraction of DNA Extracted DNA was analysed by PAGE and ethidium bromide staining Preparation and use of antibodies A cDNA sequence encoding a 30- kDa-fragment...
- 7
- 554
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
Ngày tải lên :
17/03/2014, 23:20
... Pieri, C., Gaspar, R.J., Farkas, T & Damjanovich, S (1997) HLA class I and II antigens are partially co-clustered in the plasma membrane of human lymphoblastoid cells Proc Natl Acad Sci USA 94, 7269–7274 ... separated electrophoretically on a Bio-Rad minigel apparatus (Bio-Rad, Richmond, VA, USA) and were transferred to nitrocellulose membranes (Pharmacia Biotech., San Francisco, CA, USA) Membranes ... on all the four T cell types (‡ 105 per cell) , characteristic of leukemic or activated T cells HLA-DR was abundant on all cell lines (‡ · 105 copies per cell) Surface density of class I HLA was...
- 10
- 499
- 0
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc
Ngày tải lên :
28/03/2014, 23:20
... 12, which then binds to and inactivates mTORC1, leading to an upregulation of autophagy [25] Thus mTORC1 acts as a central regulator balancing anabolic and catabolic pathways within the cell [24] ... a stop codon was introduced at amino acid 1517 using the primers: Fwd 5¢-CGACGAGTC AAACTAGCCAATCCTGCTG-3¢; Rev 5¢-CAGCAGGAT TGGCTAGTTTGACTCGTCG-3¢ Autophagy Apoptosis Fig DAPK and TSC2 form a ... beta, DNA damage, ER-stress and excessive growth factor signaling DAPK also plays a role in survival pathways reflected in its autophagy-signalling activity A substantial amount of research has...
- 17
- 368
- 0