... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005) ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures ... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably,...
Ngày tải lên: 19/02/2014, 17:20
... challenges and barriers in communication, organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication ... develop a planning framework (surge capacity and capability map) that presents all available and relevant internal and external resources This framework should be transparent, updated, and shared ... hospitals will face in a mass casualty event (MCE) include surge capacity and capability issues in emergency and trauma services, as well as medical, paramedical, administrative, logistical, and...
Ngày tải lên: 19/02/2014, 03:20
Upgrading IBM Systems Director Server on Windows and migrating to a Microsoft SQL Server or Microsoft SQL Server Express database Version 6 Release 3 pptx
... default database v Migrate your default Apache Derby database to the default managed IBM DB2 database and then switch your database to a non-default database The upgrade process automatically ... database to any type of non-default database, you cannot migrate your database data Related tasks: Configuring the database Determining your database migration path Switching the database to a ... Systems Director 6.3.x and want to use the managed IBM DB2 database instead When you switch your database to the default managed IBM DB2 database, you can migrate your database data to the managed IBM...
Ngày tải lên: 31/03/2014, 16:20
TRICHOTOMY, STABILITY, AND OSCILLATION OF A FUZZY DIFFERENCE EQUATION G. STEFANIDOU AND G. pdf
... that R1 ,a − Ra ≤ δ Da − Ar ,a + Ra La − δ (3.79) We claim that θ < La − Ra + Ar ,a − Da , a ∈ (0,1] (3.80) We fix an a ∈ (0,1] and we concider the function g(h) = Al ,a Ar ,a − Da h Al ,a Ar ,a − Da ... (3.74), and (3.76) and since (La ,Ra ) satisfies (3.7), we get L1 ,a − La = Al ,a + k i=1 ci,l ,a L− pi ,a m j =1 d j,r ,a R−q j ,a − La ≤ Al ,a + Ca − Al ,a + La Ra − (B − Z) =δ ≤δ Ra − δ Ra − δ k ... any a ∈ (0,1], there exist the limn→∞ Ln ,a , limn→∞ Rn ,a , and lim Ln ,a = La , n→∞ lim Rn ,a = Ra , n→∞ a ∈ (0,1], (3.69) where La = Al ,a Ar ,a − Ca Da , Ar ,a − Ca k i=1 ci,l ,a , m j =1 d j,r,a...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf
... camera Microvascular damage was analysed and quantified using the criteria established by Cutolo et al Essentially, dcSSc patients were graded as having an early (E), active (A) or late (L) pattern ... the nailfold capillaroscopy analysis KC provided antisera and participated in drafting the manuscript CPD provided the clinical data and analysis CMB participated in drafting the manuscript DJA ... Nailfold capillaroscopy of (a) normal and (b,c) dcSSc patients In the patients active pattern of capillary damage, frequent giant capillaries are present ((b) arrow) accompanied by moderate capillary...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Molecular model of the outward facing state of the human P-glycoprotein (ABCB1), and comparison to a model of the human MRP5 (ABCC5)" docx
... ABCC11 ABCC5 ABCC7 ABCC4 ABCC3 ABCC1 ABCC2 ABCC6 ABCC9 ABCC8 ABCC10 ABCA7 ABCA1 ABCA4 ABCA2 ABCA3 ABCA13 ABCA12 ABCA10 ABCA9 ABCA6 ABCA5 ABCG4 ABCG1 ABCG2 ABCG8 ABCG5 ABCD2 ABCD1 ABCD3 ABCD4 Figure ... ABCC, ABCD and ABCG Two main branches are seen, with ABCB, ABCC and ABCD in one branch, and ABCA and ABCG in the other branch ABCB and ABCC subfamilies are closer related to each other than to ... have indicated that TMH6 and TMH12 may take part in ligand binding [26,27,30,31] Cross-linking has also shown that TMH5 and TMH8 are near each other [28], and that TMH2 and TMH11 are near each...
Ngày tải lên: 13/08/2014, 16:21
a cross-cultural study on american-vietnamses verbal expressions in offering a gift and responding to a gift offer = nghiên cứu giao thoa văn hóa việt - mỹ về cách sử dụng ngôn từ để tặng quà và nhận quà
... gifts and responding to gift offers in Vietnamese and American languages and cultures from cross – cultural perspective In fact, what to say to give a gift, and how to respond to a gift offer are ... belong to any single person but to all people It is believed that language and culture are interrelated, language contains culture in itself and culture is expressed via language Language, as a means ... For example: they have the same age range (24-61); they all are living in the urban; and to some extent, they have the same educational background II.4 Coding of the data and mode of data analysis...
Ngày tải lên: 02/03/2015, 14:17
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... provides insight into potential errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters...
Ngày tải lên: 25/10/2012, 10:45
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... as we have seen it also has syntactic implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central ... semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives Chapter IV is to make a contrastive analysis...
Ngày tải lên: 10/04/2013, 14:46
Listening to Patients A Phenomenological Approach to Nursing Research and Practice
... heritage are valued We are Christians and Jews, Appalachians and Easterners, Black and White, men and women, young and old, graduate students and faculty All contribute their own unique and useful ... want to sit in a wheelchair okay So my husband pushed me down to therapy the first day And this big man approached me and said Tm here to help you I'll teach you to walk.' He said, 'You'll stand ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter...
Ngày tải lên: 16/10/2013, 11:15
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams
... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...
Ngày tải lên: 24/10/2013, 08:20
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt
... identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes Effects Analysis are quantitative technical failure analysis techniques ... developed into a set of targets for health and safety performance There is a danger that risk appetite statements fail to be dynamic, and they can constrain behaviour and rapid response At Board level, ... by way of two mechanisms These are monitoring and review of performance and communication and consultation Monitoring and review ensures that the organisation monitors risk performance and learns...
Ngày tải lên: 21/02/2014, 12:20
Partnering: A New Approach to Sexual and Reproductive Health doc
... Gender-Based Approach , Sexual Health Exchange 1998, no 2, pp 3–6 83 T Valdés and J Olvarríra, eds, “Masculinidades y equidad de genéro en America Latina” 21 Partnering: A New Approach To Sexual And ... me to share with people and to reach out to others and help She taught me that I am a human being first and a man second And that as a man, I should help the women publicly and privately to build ... It called for stronger legislation against all forms of domestic violence, including marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and...
Ngày tải lên: 05/03/2014, 16:20
A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot
... Sao Paolo New York Mumbai (Bombay) Los Angeles Calcutta Shanghai Dhaka Delhi Buenos Aires Jakarta Osaka Rio de Janeiro Karachi Japan Mexico Brazil USA India USA India China Bangladesh India Argentina ... Buenos Aires A Practical Approach to Water Conservation urbanisation and water stress in regions around mega-cities as a ratio of total water withdrawals divided by estimated total availability ... Europe North America Central America North Africa Central and South Asia Middle East Southeast Asia Central Africa South America Southern Africa Oceanania Virtual water trade balances of thirteen...
Ngày tải lên: 06/03/2014, 17:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... the sample to high intensity light beam, was restricted to < 3% of the initial intensity and was always taken into consideration in the analysis of the titration data Akhavan S, Mannucci PM, Lak ... Haemost 84, 989–997 De Cristofaro R, Akhavan S, Altomare C, Carotti A, Peyvandi F & Mannucci PM (2004) A natural prothrombin mutant reveals an unexpected influence of A- chain structure on the activity ... ˚ mutant (average SAS ¼ 24.9 A2 ) than in the WT form ˚ 2) A similar trend was observed (average SAS ¼ 9.3 A ˚ for Trp29 (average SAS ¼ 9.6 and 14.1 A2 in WT and DK9, respectively), whereas the...
Ngày tải lên: 07/03/2014, 12:20
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... the marketing team Total immersion encouraged a rapid growth of market and technical expertise and this favoured commercially patentable innovation (Step of The 9S Approach) Bureaucracy and administrative ... China, India and the Middle East, and maybe later against the currencies of Russia and Brazil International money markets may become nervous about lending to Greece, Spain, Portugal, Ireland,...
Ngày tải lên: 15/03/2014, 15:33
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx
... sanitation plans The National Water Supply and Sanitation Plan (Planasa) was institutionalised in 1971 during the military regime to guarantee financial resources transfers to Sanitation State ... articles and reports available online Data from books, journals, articles, and reports are accordingly cited and quoted All the material has been selected according to content and relevance to the topic, ... due to mismanagement caused by a variety of reasons Every year, rivers, lakes and coastal water receive some 36 billion tons of untreated industrial wastewater and raw sewage discharged by factories...
Ngày tải lên: 15/03/2014, 16:20
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot
... Conservation and Protection - Corporate Policy Cjroup Health and Welfare Canada National Oceanic and Atmospheric Administration (NOAA), Climate Moniloring and Diagnostic Laboratory, Boulder Colorado, ... health information to create an overall health index of use as an indicator of sustainable development IX APPROACHES TO SUSTAINABLE DEVELOPMENT INDICATORS This report spells out an approach to ... pressure and state indicators How existing economic and social indicators fit into such a framework also appears to be somewhat arbitrary A second approach, proposed by Peter Bartelmus of UNSTAT,...
Ngày tải lên: 15/03/2014, 16:20