speed of light in vacuum c
Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients
Ngày tải lên :
31/10/2012, 17:08
... Digoxin, Serum concentration, Heart failure, Renal clearance
1. Introduction
Cystatin C (Cys -C) is a non-glycosylated cationic
protein of 13.3 kDa, belonging to the cystatin superfamily
of cysteine ... Okumura K. Factors influencing the prediction of steady
state concentrations of digoxin. Biol Pharm Bull. 2001;
24(4):403–408.
22. Cockcroft DW, Gault MH. Prediction of creatinine clearance from ...
level of Cys -C to diagnose a certain class of heart diseases,
including heart failure, has recently been suggested
based on the fact that the serum level of Cys -C, not of Cr,
was higher in such...
- 5
- 523
- 0
focuses on expressions of criticizing in American and Vietnamese e-newspapers in the light of Directness/Indirectness
Ngày tải lên :
06/04/2013, 08:43
... magazine, or an academic journal). Critics often
specialize in one field and are usually well educated in that field.
According to Wikipedia online dictionary, “Criticism is the activity of judgment ... and define the theoretical basis of public address. It also
contributes to setting up a standard of society. In particular, criticism interprets the function
of communication and indicates the ... the word criticism because it brings to mind of
something uncomfortable. However, criticism comes into two flavors: constructive and
destructive. Destructive criticism aims to hurt an individual’s...
- 37
- 832
- 1
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY
Ngày tải lên :
22/07/2013, 01:27
... Q5
ACTION PLAN
MAKING A CHART OF THE
ENERGY CONSUMPTION IN
H .C. M. CITY
ACTIVITIES
All Ss .in each group should do their
real assignement to be able to collect
the own amounts of the city ... duty
Completing the group’s duty
7
7
Having the creative combination’s
Having the creative combination’s
ideas
ideas
+1
+1
Having plenty of properly
Having plenty of properly
illustrated pictures
illustrated ... their
charts in front of the class and share the best
charts in front of the class and share the best
way to the web site of the resources file of City
way to the web site of the resources file...
- 8
- 406
- 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
Ngày tải lên :
17/02/2014, 14:20
... permission in writing from the publisher.
Engineering Mechanics - Statics Chapter 2
Problem 2-15
Resolve the force
F
1
into components acting along the u and v axes and determine the magnitudes
of ... material may
be reproduced, in any form or by any means, without permission in writing from the publisher.
Engineering Mechanics - Statics Chapter 2
Since
cos 180deg
φ
−
()
cos−
φ
()
=
,
F
R
F
1
2
F
2
2
+ ... by any means, without permission in writing from the publisher.
Engineering Mechanics - Statics Chapter 2
Problem 2-24
Resolve the force
F
into components acting along (a) the x and y axes,...
- 1.1K
- 1.1K
- 2
Tài liệu Báo cáo khoa học: Dimers of light-harvesting complex 2 from Rhodobacter sphaeroides characterized in reconstituted 2D crystals with atomic force microscopy docx
Ngày tải lên :
18/02/2014, 18:20
... absence of a 3D crystallo-
graphic structure, we assigned an intrinsic curvature to
the LH2 of Rhodob. sphaeroides that could originate
from a slight conical shape or speci c binding of a
curved ... observed
tilt of LH2’s within the square lattice was not due to
an intrinsic property of LH2’s of Rhodop. acidophila,
but was caused by speci c interactions induced by
packing. In contrast, tilted ... square-packing lattices
represent a less packed configuration, indicating that
dense packing may induce the speci c interactions
leading to zig-zagging LH2’s. The intermediate density
of the dimer...
- 10
- 526
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
Ngày tải lên :
19/02/2014, 17:20
... Predicted amino acid sequence of TNSALP (1559delT). A
single T deletion in the cDNA at nucleotide 1559 of tissue nonspe-
ci c alkaline phosphatase (TNSALP) changes the amino acid
sequence at leucine ... [
35
S]methionine ⁄ cys-
teine at 30 C for 90 min in the absence or presence of
canine pancreatic microsomal membrane as described previ-
ously [14].
Metabolic labelling and immunoprecipitation
For ... SCF
Fbs2
ubiquitin ligase com-
plex, which specifically targets N-linked high-mannose-
type oligosaccharide chains of glycoproteins [31]. The
involvement of EDEM and ⁄ or SCF
Fbs2
in the degrada-
tion of TNSALP...
- 14
- 445
- 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf
Ngày tải lên :
19/02/2014, 18:20
... 5¢-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA
TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA
TCGGAGTTCGGACA-3¢ into the unique SpeI restriction
site. p13R4-DP was obtained by replacing the B10 tag of
the p13R4 construct ... 5¢-ACTCATA
CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and
5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA
GAAGC-3¢ were used for the PCR amplification of the
C- terminal region of d1-EGFP corresponding to the mouse
ornithine decarboxylase ... sequence (amino acids
422–461 [18]). The B10 tag was subsequently added to the
resulting plasmid by cloning the following annealed oligo-
nucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC
CGTCAGGGCGGTCGCGAACGTTTAG-3¢...
- 14
- 483
- 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
Ngày tải lên :
07/03/2014, 04:20
... Protein precipitation was monitored by light
scattering at 360 nm. Assays were performed in duplicate.
The precipitation of 45 lm insulin from bovine pancreas in
the presence of increasing concentrations ... on pro-
teins that contain exposed clusters of hydrophobic ami-
noacyl residues, resulting in an increase in fluorescence
[39]. ANS binding fluorescence of wild-type and mutant
Hsp25 reached a maximum ... activity [21].
Conversely, an increase in the charge of the extension
of aA-crystallin results in no significant changes in
chaperone activity relative to wild-type aA-crystallin
[26,27], highlighting...
- 14
- 417
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... slow folding in
cytochrome. C Acc Chem Res 31, 737–744.
30 Shastry MCR, Sauder JM & Roder H (1998) Kinetic
and structural analysis of submillisecond folding
events in cytochrome. C Acc Chem Res ... structural changes
being minimal the trapping of two main-chain confor-
mations and increased B-factors at 295 K suggests that
the presence of the coordinating Lys in some way can
in uence the ... heme, sufficient movement of the loop
containing the Met ligand connecting helices four and
five must occur [19–22]. At present two X-ray struc-
tures of cyts c
2
exist in which the coordinating Met-
iron...
- 15
- 509
- 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx
Ngày tải lên :
08/03/2014, 16:20
... I282Q
(forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢
for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG
CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT
GGCACATCTA-3¢ for I282Q (reverse), 5¢-ACTGCTG
GGTATGCTGGGCGT-3¢ for ... Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢
for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG
GC-3¢ for H407A. The selection restriction site mutation
was created by primer 5¢-GTAGCTGACTGGAGCATG
CAT-3¢ mutating a unique ... performed in
C3 A cells (ATCC, CRL-10741, lot
i
1414101) in 6-well plates.
C3 A cells were seeded at a concentration of 5 · 10
5
cells in
each well and incubated for 24 h at 37 °Cin2mLgrowth
medium containing...
- 9
- 552
- 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt
Ngày tải lên :
15/03/2014, 09:20
... (ssDNA70) was obtained by labeling 100 pmol of
HPLC-purified primer WT (5¢-AATTGATCCCGCCCG
CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA
ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of
[c-
32
P]ATP (3000 CiÆ mmol
)1
; ... extracts, consistent
with the truncation affecting part of domain X. Inter-
estingly, mutants with shorter C- terminal truncations
(DC14 and DC21) displayed no detectable splicing
activity in vivo. ... high-affinity binding site
in subdomain DIVa of the intron, whereas other
regions of the RT and domain X interact with con-
served catalytic core regions [12]. Domain X is located
in the position corresponding...
- 11
- 398
- 0
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
Ngày tải lên :
15/03/2014, 15:33
... spectrum of 7a could not be obtained in LC
−
MS/MS analysis because of its very low concentration in the dichloromethane fraction.
Quantification of Vitamin E and
γ
-Oryzanol Components in
Rice ... Biological effects of oxysterols: Current status. Food Chem.
Toxicol. 1996, 34, 193-211.
milling process. According to the information of Riceland Foods, Inc.,
rice germ is about 20% of full-fat ... monitored by comparing the UV and MS peak areas of
IS to the LC-MS/MS analyses. Calibration curves of each standard
were created from seven concentrations using Microsoft Excel software.
The concentrations...
- 6
- 649
- 1
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx
Ngày tải lên :
16/03/2014, 02:20
... physiologically relevant redox state
or of the second so-called light- harvesting chromo-
phore which is used to enhance the quantum yield
of the photoreaction by increasing the extinction
coefficient in ... determination in para-
magnetic proteins and biomolecules [37,38]. In brief,
using ENDOR spectroscopy, hyperfine couplings of a
particular nucleus can be determined directly from
pairs of resonance ... essential amino acids for 64PP repair is crucial for
a thorough understanding of the light- independent
catalytic steps preceding blue -light initiated enzymatic
DNA repair, and the speci c structural...
- 14
- 379
- 0
Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot
Ngày tải lên :
16/03/2014, 06:20
... introduced side chain in uenced the charac-
teristics of the enzyme. These results indicate that residues in the helicase
domain of nonstructural protein 3 can in uence the protease, supporting
our ... previously used
gene construct for full-length HCV NS3 [9] were introduced
by PCR using Q526A forward primer (5¢-TCCCGTGTGT
GCAGACCATCTTGAAT-3¢), H528A forward primer
(5¢-TCCCGTGTGTCAAGACGCTCTTGAAT-3¢) ... the
functional importance of the helicase domain for the
activity and inhibition of the protease, and have
focused on the identification of speci c helicase resi-
dues which may be involved. In the crystal...
- 8
- 308
- 0
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
Ngày tải lên :
16/03/2014, 06:20
... aN21 4C ⁄ cA6 2C +++
aN23 0C ⁄ cT6 7C +++ aN21 4C ⁄ cI6 3C ND
aN23 0C ⁄ cG6 8C ± aN21 4C ⁄ cP6 4C ND
aN23 0C ⁄ cI6 9C +++ aN21 4C ⁄ cM6 5C +++
aN23 0C ⁄ cY7 0C +++ aN21 4C ⁄ cI6 6C +
aA23 3C ⁄ cI6 9C +
aA21 7C ⁄ cM6 5C ... ±
aA23 3C ⁄ cY7 0C +++ aA21 7C ⁄ cI6 6C ±
aI23 7C ⁄ cV7 3C +++ aI22 1C ⁄ cG6 9C +++
aG23 9C ⁄ cL7 6C + aI22 3C ⁄ cL7 2C +++
aG23 9C ⁄ cI7 7C ± aI22 3C ⁄ cY7 3C ND
aL24 0C ⁄ cL7 6C ++ aL22 4C ⁄ cL7 2C +
aL24 0C ⁄ cI7 7C ... structural and functional
knowledge of the c- ring.
Characterization of the a ⁄ c interface by cysteine
cross-linking experiments
Cell membranes, containing combined cysteine substi-
tutions in...
- 14
- 592
- 0
