sounding or does not sound

... Mordechai Smith, Jonathan Katz, and Laura Weber for assistance with experiments This work was supported by grants from Genelux Corporation (R&D facility in San Diego, CA, USA) D Haddad, visitor ... detect tumor origin and, more importantly, presence of metastases may be possible [3] Here, we report on the construction and testing of a VACV carrying the human sodium iodide symporter (hNIS) ... data were corrected for (a) nonuniformity of scanner response using a uniform cylinder source-based normalization, (b) dead time count losses using a singlecount rate-based global correction,...

Ngày tải lên: 18/06/2014, 19:20

... Mordechai Smith, Jonathan Katz, and Laura Weber for assistance with experiments This work was supported by grants from Genelux Corporation (R&D facility in San Diego, CA, USA) D Haddad, visitor ... detect tumor origin and, more importantly, presence of metastases may be possible [3] Here, we report on the construction and testing of a VACV carrying the human sodium iodide symporter (hNIS) ... data were corrected for (a) nonuniformity of scanner response using a uniform cylinder source-based normalization, (b) dead time count losses using a singlecount rate-based global correction,...

Ngày tải lên: 20/06/2014, 03:20

... growth factor, or transforming growth factor Inter- and intra-assay variances for VEGF, sVEGFR-1, and sVCAM-1 were lower than 10% The minimum detectable concentration was less than pg/ml for VEGF, ... nonsmokers from the laboratory staff Study design Patients were asked to stop taking calcium-channel blockers days before hospitalisation The baseline evaluation was performed on the morning of admission ... activities specific for endothelial cells It interacts with two receptor tyrosine kinases, VEGFR-1 (flt) and VEGFR-2 (flk) A defect in VEGF receptors could account for VEGF signalling abnormalities in...

Ngày tải lên: 09/08/2014, 01:23

... CTGF -945 promoter polymorphism does not confirm association with systemic sclerosis susceptibility or phenotype Ann Rheum Dis 2009, 68:1618-1620 Nguyen TQ, Tarnow L, Jorsal A, Oliver N, Roestenberg ... incidence of ESRD, total mortality, cardiovascular mortality, or nonfatal cardiovascular events between the different genotypes Page of (all p > 0.05) None of the normoalbuminuric patients developed ... serum or plasma CTGF levels with genotype has not been assessed This hampers an adequate interpretation of the effect of the polymorphism on in vivo CTGF transcription and translation Therefore,...

Ngày tải lên: 11/08/2014, 07:21

... three were sent for slaughter At the abattoir carcass weight, lean meat percentage, fat measurements and a health control of inner organs was recorded individually for every pig according to the ... Gastric lesions, score Control group Treatment group Figure lesions (n = between daily weight gain and each of gastric Correlation indicates the number of pigs in score category) Correlation between ... present study does not support the use of increased feeding occasions in fattening pigs 14 15 16 Competing interests The authors declare that they have no competing interests 17 Authors' contributions...

Ngày tải lên: 12/08/2014, 18:22

... jugular and 11 femoral) did not affect the risk of malfunction One internal jugular cannula was repositioned, and one was replaced for poor flow One femoral cannula was replaced for poor flow Discussion ... http://ccforum.com/content/6/5/452 Introduction Prone positioning for respiratory failure has recently gained popularity as an adjunct for the treatment of respiratory failure and adult respiratory ... ECMO, extracorporeal membrane oxygenation; RIJ, right internal jugular vein; RFem, right femoral vein; LFem, left femoral vein Available online http://ccforum.com/content/6/5/452 ing worldwide,...

Ngày tải lên: 12/08/2014, 19:21

... treatment for localized infection, severe sepsis and septic or cardiogenic shock, including source control, fluid infusion, catecholamine infusion, replacement and /or support therapy for organ failure, ... number not for citation purposes) In shock with preserved or even increased oxygen extraction, such as haemorrhagic shock, StO2 (as measured by NIRS in skeletal muscle, stomach and liver) correlated ... of SvO2; furthermore, the trend in StO2 may be considered a surrogate for the trend in SvO2 Authors' contributions MP was responsible for conception and design of the study; for acquisition of...

Ngày tải lên: 13/08/2014, 03:20

... patients needing morphine, midazolam, or propofol Figure shows the percentage of patients (either mechanically ventilated or liberated from the ventilator) needing morphine, midazolam, or propofol ... not for citation purposes) χ2 test VT are not supported by the findings of the present study; after implementing this strategy in our ICU, patients did not require higher levels of sedation or ... Evaluation (APACHE) II score The diagnosis of ALI/ARDS was made by two investigators (EKW and MJS) using the consensus criteria for ALI/ ARDS [7] Ventilator settings were recorded at four different...

Ngày tải lên: 13/08/2014, 08:20

... cellular receptors for ET-1 are the endothelin A receptor (ETAR) and the endothelin B receptor (ETBR) [10,11] The expression of ETAR and ETBR are different between quiescent and activated HSC or between ... incorporation into DNA was measured in × 103 HSC during 48 h and at different concentrations of FCS Absorbance values of controls were set as 100% for each concentration of FCS and values normalized ... activated but not early HSC, and that ET-1 does not contribute to liver fibrosis due to stimulation of HSC proliferation Although ET-1 has been described as a survival factor for various kinds...

Ngày tải lên: 13/08/2014, 13:20

... important source of heterogeneity of financial titles Furthermore, every new crash or crisis invokes calls for additional and more timely information For example, the Asia crisis resulted in more ... procuring information on investors to savers and by selecting and monitoring investors on behalf of savers That is not their job They deal in money and in risk, not in information per se Information ... alternative for the market This view laid the foundation for the transaction cost theory (see Williamson, 1988), for the agency theory (Jensen and Meckling, 1976), and for the theory of asymmetric information...

Ngày tải lên: 24/10/2012, 09:11

... Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does Not Work for ... implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory in developed countries but ... developed countries but there is little evidence that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS...

Ngày tải lên: 18/10/2013, 14:15

... thấy hình đoạt giải chụp máy Holga trưng bày gallery Hemicycle Bảo tàng nghệ thuật Corcoran thi Eyes of History vào năm 2006 tổ chức White House News Photographers Walker Evans có lần nói “Mọi ... thú vị Haas kể Murad Saÿen, nhà nhiếp ảnh tiếng từ Oxford,Maine mà người ngưỡng mộ Nhiều người nói ông bất ngờ xuất từ hư không kết hợp Eliot Porter Henri Cartier Bresson Tôi tìm thấy trang web ... mua Leica nể trọng Ernst ông dùng máy Leica (cho dù ông dùng máy Nikon để chụp ảnh quảng cáo Marlboro lừng danh mình) Sau ngày trại sáng tác này, ông chịu hết thần tượng Leica mức mà người trẻ tuổi...

Ngày tải lên: 13/12/2013, 18:15

... spouse does not have enough tax withheld or does not pay enough estimated tax Should You Use Another Form? Even if you can use Form 1040EZ, it may benefit you to use Form 1040A or 1040 instead For ... required to file Form 8889 (see the instructions for Form 8889) Must file Form 1040 Must file Form 1040 Must file Form 1040 Must file Form 1040A or 1040 to deduct Must file Form 1040A or 1040 to claim, ... for the tax Must file Form 1040 if required to file Form 8853 (see the instructions for Form 8853) Must file Form 1040 Must file Form 1040 to deduct Must file Form 1040 Must file Form 1040A or...

Ngày tải lên: 16/02/2014, 03:20

... Reported Having Three or Fewer Choices for Auditor Figure 5: Percentage of Small and Midsize Companies Reporting They Did Not Have Enough Choices for Auditor Figure 6: Changes in Auditors among Small ... regarding financial reporting Audit committee members must be independent Section 302: Corporate Responsibility for Financial Reports For each annual and quarterly report filed with SEC, the ... certify that he or she has reviewed the report and that, based on his or her knowledge, the report does not contain any untrue statement; the certifying officers are responsible for internal controls;...

Ngày tải lên: 18/02/2014, 05:20

... (1 : 10 000 dilution; Vector Laboratories, Burlingame, CA, USA) After extensive washing, membranes were incubated with avidinbiotin conjugated peroxidase (Vector Laboratories) solution in TBS-T ... phospholipid phosphate, respectively; P < 0.01; n ¼ mice per genotype) An up-regulation of that order is found for both COX isoforms, as well as for cytochrome c On the other hand, the up-regulation of ... was much less pronounced than for both COX isoforms (44% and 71% increase for COX I and COX Vb, respectively) and for cytochrome c (34%) Ca2+ signals play an important role in the regulation of...

Ngày tải lên: 19/02/2014, 07:20

... null,” according to the study’s authors Koch, et al., explain that “making abortion illegal is not Abortion illegal Abortion legal Abortion illegal Abortion legal Abortion illegal Abortion legal ... world.” Universal Declaration of Human Rights Care for women is needed Legal abortion only leads to more abortions and, as a result, more unborn children killed and more abortion-related Endnotes ... to death if not treated promptly Legal abortion does nothing to solve the underlying problem of poor medical care in the developing world In fact, abortion is detrimental to both unborn children...

Ngày tải lên: 05/03/2014, 15:20

... course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Cristobal, S., de Gier, J.W., ... of the TorA signal peptide, TAG-stop codons were incorporated in 100TorA/ P2 either at position 13, two residues downstream of the conserved arginine pair, or within the hydrophobic core at position ... Role of trigger factor in Tat-mediated export (Eur J Biochem 271) 4781 directly by SDS/PAGE or immunoprecipitated first using 3-fold the amount used for direct analysis The TorA signal peptide...

Ngày tải lên: 07/03/2014, 16:20

... to Dr Elliot Danforth, Jr., for his research support This study was supported by a Biomedical Research Support Grant from the University of Vermont, College of Medicine (M I Goran), the American ... adjusting for thermic response to feeding and energy cost of structured activity See METHODS for more details r = 0.59, P = 0.06, respectively) Individual data for resting metabolic rate before and ... 0.05) According to a 3-day self-recorded intake diary, there was no significant change in reported energy intake (1,883 & 595 kcal/day before exercise vs 2,083 + 489 kcal/day after exercise) or food...

Ngày tải lên: 14/03/2014, 20:20

... using algorithms from LSM Software Release 3.2 (Carl Zeiss, Welwyn Garden City, UK) Tissue preparations were mounted in Vectashield medium (Vector Laboratories, Peterborough, UK) The fluorophore used ... degeneration Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be reorganized for online ... isoform in Nmnat1+ ⁄ ) compared with wild-type, showing that while NMNAT1 mRNA expression is reduced, NMNAT2 and mRNA relative expression is not changed Normalization was performed for each isoform...

Ngày tải lên: 22/03/2014, 16:20

... GenBank accession number MAP1b-for MAP1b-rev MAP2-for MAP2-rev Tau-for Tau-rev STOP-for STOP-rev Doublecortin-for Doublecortin-rev LIS1-for LIS1-rev Tubulin a6-for Tubulin a6-rev GAGCTGGAGCCAGTTGAGAAGCAGGG ... information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting ... doublecortin (A, left) and to LIS1 (A, right) As positive controls, samples of cytosolic fractions from adult or newborn mouse brain (for LIS1 or doublecortin, respectively) were included (Br) For...

Ngày tải lên: 23/03/2014, 05:22